Incidental Mutation 'R8833:Dip2c'
ID673992
Institutional Source Beutler Lab
Gene Symbol Dip2c
Ensembl Gene ENSMUSG00000048264
Gene Namedisco interacting protein 2 homolog C
Synonyms2900024P20Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.776) question?
Stock #R8833 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location9276528-9668928 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 9575483 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]
Predicted Effect probably benign
Transcript: ENSMUST00000166299
SMART Domains Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 801 3.6e-23 PFAM
Pfam:AMP-binding 977 1451 1.5e-72 PFAM
low complexity region 1514 1526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169960
SMART Domains Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264

DomainStartEndE-ValueType
DMAP_binding 7 176 3.02e-37 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Pfam:AMP-binding 380 637 5.9e-10 PFAM
SCOP:d1lci__ 675 875 2e-8 SMART
Pfam:AMP-binding 947 1421 1.2e-56 PFAM
low complexity region 1484 1496 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174552
SMART Domains Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 800 2.7e-20 PFAM
Pfam:AMP-binding 976 1450 1.3e-56 PFAM
low complexity region 1513 1525 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik C T 14: 49,773,861 V130I probably benign Het
Akr1c6 T A 13: 4,446,378 D132E possibly damaging Het
Atp10b A G 11: 43,222,159 E844G probably damaging Het
Bbx T A 16: 50,225,266 M311L probably benign Het
Bzw2 A T 12: 36,119,070 M153K probably benign Het
C1qtnf6 G T 15: 78,525,374 T91K probably benign Het
Cdh4 A G 2: 179,894,035 D793G possibly damaging Het
Ces4a A G 8: 105,131,982 I11V probably benign Het
Cpne9 T C 6: 113,304,512 L518P probably damaging Het
Fam129a T A 1: 151,644,930 V125E probably damaging Het
Fam135b T C 15: 71,462,934 N804D probably benign Het
Frem3 G A 8: 80,612,772 D565N probably benign Het
Fscb T A 12: 64,473,223 T490S unknown Het
Fuca1 A G 4: 135,920,895 D31G probably damaging Het
Gbp8 G T 5: 105,018,802 N220K possibly damaging Het
Gfra2 T C 14: 70,925,897 F207L probably damaging Het
Gm9495 A T 8: 69,429,330 D331E probably benign Het
Grap2 A G 15: 80,638,483 N70S probably benign Het
Ifna13 C A 4: 88,643,920 E156* probably null Het
Jmjd1c G A 10: 67,218,383 R22H probably benign Het
Macf1 A G 4: 123,471,341 V3209A probably benign Het
Muc5b A G 7: 141,858,368 T1684A unknown Het
Naip5 T A 13: 100,222,934 E598V probably damaging Het
Notch1 G A 2: 26,481,603 T278I probably damaging Het
Olfr1426 A G 19: 12,088,279 V171A possibly damaging Het
Olfr177 A T 16: 58,872,596 Y185N probably damaging Het
Olfr618 T G 7: 103,598,237 F307C possibly damaging Het
Olfr729 A T 14: 50,148,366 C169* probably null Het
Orm1 A T 4: 63,344,701 E35V probably damaging Het
Pak1 T A 7: 97,854,632 I58N possibly damaging Het
Pard3b A G 1: 62,344,999 E841G probably benign Het
Pcdhb9 G T 18: 37,401,415 R154I probably benign Het
Pdpr G A 8: 111,125,680 V560I probably damaging Het
Pkdcc T C 17: 83,223,926 F455L probably damaging Het
Pus7l A T 15: 94,540,262 F234Y probably damaging Het
Rab3gap2 T A 1: 185,258,525 L632Q probably damaging Het
Rarb T A 14: 16,819,015 probably benign Het
Rom1 A T 19: 8,928,107 H236Q possibly damaging Het
Secisbp2 T C 13: 51,665,316 S311P probably benign Het
Slc26a1 T C 5: 108,672,316 D355G probably benign Het
Slc28a3 C T 13: 58,559,263 A574T probably damaging Het
Sox11 A G 12: 27,342,314 V32A possibly damaging Het
Spata17 T C 1: 187,183,239 Y107C probably damaging Het
Speer1 C A 5: 11,344,238 Y104* probably null Het
Stxbp5l T C 16: 37,204,452 T595A probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Tatdn2 T G 6: 113,707,387 I674S probably damaging Het
Tex14 T A 11: 87,493,052 S189R probably benign Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Tor3a T C 1: 156,655,803 T350A probably benign Het
Trove2 T A 1: 143,765,779 K315* probably null Het
Ttr T G 18: 20,666,493 V36G probably damaging Het
Vmn1r129 A T 7: 21,361,280 H4Q probably null Het
Vmn1r32 A G 6: 66,553,639 M51T possibly damaging Het
Zfp141 T C 7: 42,476,263 T262A possibly damaging Het
Zfp980 T A 4: 145,701,026 N108K probably benign Het
Other mutations in Dip2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dip2c APN 13 9493108 missense probably damaging 0.97
IGL00426:Dip2c APN 13 9606515 missense probably damaging 1.00
IGL00503:Dip2c APN 13 9567898 missense probably damaging 1.00
IGL00586:Dip2c APN 13 9610755 missense probably damaging 1.00
IGL01306:Dip2c APN 13 9575143 missense possibly damaging 0.72
IGL01580:Dip2c APN 13 9637088 splice site probably null
IGL01985:Dip2c APN 13 9553267 splice site probably benign
IGL02060:Dip2c APN 13 9622630 missense probably damaging 0.98
IGL02122:Dip2c APN 13 9506659 missense possibly damaging 0.48
IGL02170:Dip2c APN 13 9606335 missense probably benign 0.03
IGL02211:Dip2c APN 13 9610847 missense probably damaging 1.00
IGL02755:Dip2c APN 13 9550320 critical splice donor site probably null
IGL02836:Dip2c APN 13 9610790 missense probably damaging 0.98
IGL02935:Dip2c APN 13 9662146 missense probably damaging 1.00
IGL03032:Dip2c APN 13 9551778 missense probably damaging 1.00
ANU23:Dip2c UTSW 13 9575143 missense possibly damaging 0.72
P0038:Dip2c UTSW 13 9646982 missense probably damaging 1.00
R0009:Dip2c UTSW 13 9621903 missense probably damaging 1.00
R0268:Dip2c UTSW 13 9637150 missense probably damaging 1.00
R0271:Dip2c UTSW 13 9615775 missense probably damaging 1.00
R0306:Dip2c UTSW 13 9604599 missense probably benign 0.09
R0415:Dip2c UTSW 13 9568289 splice site probably benign
R0519:Dip2c UTSW 13 9563208 missense probably damaging 1.00
R0557:Dip2c UTSW 13 9553459 missense possibly damaging 0.81
R0964:Dip2c UTSW 13 9568663 missense probably benign 0.43
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0974:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R1101:Dip2c UTSW 13 9634744 missense probably damaging 1.00
R1171:Dip2c UTSW 13 9493126 missense possibly damaging 0.89
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1432:Dip2c UTSW 13 9553304 missense probably damaging 0.99
R1481:Dip2c UTSW 13 9551866 critical splice donor site probably null
R1588:Dip2c UTSW 13 9665864 missense probably damaging 1.00
R1721:Dip2c UTSW 13 9659368 missense probably damaging 1.00
R1726:Dip2c UTSW 13 9575428 missense probably damaging 1.00
R1867:Dip2c UTSW 13 9621949 missense possibly damaging 0.55
R1909:Dip2c UTSW 13 9533350 missense probably benign 0.00
R2013:Dip2c UTSW 13 9567846 nonsense probably null
R2022:Dip2c UTSW 13 9551800 missense probably damaging 1.00
R2517:Dip2c UTSW 13 9609005 missense probably damaging 1.00
R3746:Dip2c UTSW 13 9601473 missense probably damaging 1.00
R3794:Dip2c UTSW 13 9604561 missense probably damaging 0.99
R3884:Dip2c UTSW 13 9551858 missense probably damaging 1.00
R4019:Dip2c UTSW 13 9614365 missense probably damaging 0.99
R4110:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4111:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4113:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4256:Dip2c UTSW 13 9609056 missense probably damaging 1.00
R4300:Dip2c UTSW 13 9610711 missense probably damaging 1.00
R4494:Dip2c UTSW 13 9571062 missense possibly damaging 0.64
R4739:Dip2c UTSW 13 9533339 missense probably damaging 0.98
R4812:Dip2c UTSW 13 9637130 nonsense probably null
R4814:Dip2c UTSW 13 9536860 missense probably benign 0.07
R4816:Dip2c UTSW 13 9575150 missense probably benign 0.37
R4828:Dip2c UTSW 13 9560679 missense probably damaging 1.00
R4915:Dip2c UTSW 13 9621869 splice site probably null
R4917:Dip2c UTSW 13 9621869 splice site probably null
R4932:Dip2c UTSW 13 9623972 missense probably damaging 0.99
R4993:Dip2c UTSW 13 9575223 nonsense probably null
R5043:Dip2c UTSW 13 9551827 missense possibly damaging 0.80
R5349:Dip2c UTSW 13 9622653 missense probably damaging 1.00
R5744:Dip2c UTSW 13 9568405 missense probably damaging 1.00
R5840:Dip2c UTSW 13 9506676 missense possibly damaging 0.68
R6110:Dip2c UTSW 13 9623766 missense probably damaging 1.00
R6160:Dip2c UTSW 13 9533254 missense probably benign 0.01
R6161:Dip2c UTSW 13 9647007 missense probably damaging 1.00
R6477:Dip2c UTSW 13 9623760 missense probably damaging 1.00
R6522:Dip2c UTSW 13 9575228 critical splice donor site probably null
R6603:Dip2c UTSW 13 9654588 splice site probably null
R6658:Dip2c UTSW 13 9493177 critical splice donor site probably null
R6672:Dip2c UTSW 13 9567830 critical splice acceptor site probably null
R6697:Dip2c UTSW 13 9621913 missense probably damaging 1.00
R6991:Dip2c UTSW 13 9551860 nonsense probably null
R6991:Dip2c UTSW 13 9634832 missense probably damaging 1.00
R7018:Dip2c UTSW 13 9659278 missense probably damaging 1.00
R7053:Dip2c UTSW 13 9610704 missense probably damaging 1.00
R7102:Dip2c UTSW 13 9604536 missense probably benign 0.01
R7171:Dip2c UTSW 13 9506648 missense probably benign 0.34
R7371:Dip2c UTSW 13 9592749 missense probably benign 0.02
R7395:Dip2c UTSW 13 9614377 missense probably damaging 1.00
R7489:Dip2c UTSW 13 9533312 missense probably damaging 0.99
R7575:Dip2c UTSW 13 9628012 missense probably damaging 0.97
R7642:Dip2c UTSW 13 9622705 critical splice donor site probably null
R7687:Dip2c UTSW 13 9604581 missense probably benign 0.00
R7699:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7700:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7715:Dip2c UTSW 13 9614391 missense probably damaging 1.00
R7842:Dip2c UTSW 13 9606533 critical splice donor site probably null
R7845:Dip2c UTSW 13 9609044 missense probably damaging 1.00
R8354:Dip2c UTSW 13 9621882 missense probably benign 0.05
R8685:Dip2c UTSW 13 9637125 missense probably benign 0.01
R8779:Dip2c UTSW 13 9610809 missense probably damaging 0.98
R8786:Dip2c UTSW 13 9615794 missense probably damaging 0.99
R8815:Dip2c UTSW 13 9623798 nonsense probably null
R8868:Dip2c UTSW 13 9575467 missense possibly damaging 0.73
R8873:Dip2c UTSW 13 9575146 missense probably benign 0.03
R8923:Dip2c UTSW 13 9623865 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGCTACACACAGCCTGGC -3'
(R):5'- GGAACTGTCTCTATAGAACCTGGG -3'

Sequencing Primer
(F):5'- TGGCAGTGACACACGATAACTTC -3'
(R):5'- TGCTGACTGTGAACACCTTG -3'
Posted On2021-07-15