Incidental Mutation 'R8833:Ttr'
ID 674008
Institutional Source Beutler Lab
Gene Symbol Ttr
Ensembl Gene ENSMUSG00000061808
Gene Name transthyretin
Synonyms prealbumin
MMRRC Submission 068661-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R8833 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 20798337-20807378 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 20799550 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 36 (V36G)
Ref Sequence ENSEMBL: ENSMUSP00000074783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075312]
AlphaFold P07309
Predicted Effect probably damaging
Transcript: ENSMUST00000075312
AA Change: V36G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074783
Gene: ENSMUSG00000061808
AA Change: V36G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TR_THY 27 147 5.95e-91 SMART
Meta Mutation Damage Score 0.9025 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: This gene encodes a carrier protein responsible for the transport of thyroid hormones and retinol. The protein consists of a tetramer of identical subunits. Due to increased stability of the tetramer form of this encoded protein in mouse, compared to the human protein, this gene product has a reduced tendency to form amyloid fibrils. In humans, this protein binds beta-amyloid preventing its aggregation and providing a neuroprotective role in Alzheimer's disease. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous mutation of this gene results in decreased circulating thyroxine, triiodothyronine, and retinol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c6 T A 13: 4,496,377 (GRCm39) D132E possibly damaging Het
Armh4 C T 14: 50,011,318 (GRCm39) V130I probably benign Het
Atp10b A G 11: 43,112,986 (GRCm39) E844G probably damaging Het
Bbx T A 16: 50,045,629 (GRCm39) M311L probably benign Het
Bzw2 A T 12: 36,169,069 (GRCm39) M153K probably benign Het
C1qtnf6 G T 15: 78,409,574 (GRCm39) T91K probably benign Het
Cdh4 A G 2: 179,535,828 (GRCm39) D793G possibly damaging Het
Ces4a A G 8: 105,858,614 (GRCm39) I11V probably benign Het
Cpne9 T C 6: 113,281,473 (GRCm39) L518P probably damaging Het
Dip2c T A 13: 9,625,519 (GRCm39) probably null Het
Fam135b T C 15: 71,334,783 (GRCm39) N804D probably benign Het
Frem3 G A 8: 81,339,401 (GRCm39) D565N probably benign Het
Fscb T A 12: 64,519,997 (GRCm39) T490S unknown Het
Fuca1 A G 4: 135,648,206 (GRCm39) D31G probably damaging Het
Gbp8 G T 5: 105,166,668 (GRCm39) N220K possibly damaging Het
Gfra2 T C 14: 71,163,337 (GRCm39) F207L probably damaging Het
Grap2 A G 15: 80,522,684 (GRCm39) N70S probably benign Het
Ifna13 C A 4: 88,562,157 (GRCm39) E156* probably null Het
Jmjd1c G A 10: 67,054,162 (GRCm39) R22H probably benign Het
Macf1 A G 4: 123,365,134 (GRCm39) V3209A probably benign Het
Muc5b A G 7: 141,412,105 (GRCm39) T1684A unknown Het
Naip5 T A 13: 100,359,442 (GRCm39) E598V probably damaging Het
Niban1 T A 1: 151,520,681 (GRCm39) V125E probably damaging Het
Notch1 G A 2: 26,371,615 (GRCm39) T278I probably damaging Het
Or4d10c A G 19: 12,065,643 (GRCm39) V171A possibly damaging Het
Or4k5 A T 14: 50,385,823 (GRCm39) C169* probably null Het
Or52z13 T G 7: 103,247,444 (GRCm39) F307C possibly damaging Het
Or5k14 A T 16: 58,692,959 (GRCm39) Y185N probably damaging Het
Orm1 A T 4: 63,262,938 (GRCm39) E35V probably damaging Het
Pak1 T A 7: 97,503,839 (GRCm39) I58N possibly damaging Het
Pard3b A G 1: 62,384,158 (GRCm39) E841G probably benign Het
Pcdhb9 G T 18: 37,534,468 (GRCm39) R154I probably benign Het
Pdpr G A 8: 111,852,312 (GRCm39) V560I probably damaging Het
Pkdcc T C 17: 83,531,355 (GRCm39) F455L probably damaging Het
Potefam3c A T 8: 69,881,982 (GRCm39) D331E probably benign Het
Pus7l A T 15: 94,438,143 (GRCm39) F234Y probably damaging Het
Rab3gap2 T A 1: 184,990,722 (GRCm39) L632Q probably damaging Het
Rarb T A 14: 16,819,015 (GRCm38) probably benign Het
Ro60 T A 1: 143,641,517 (GRCm39) K315* probably null Het
Rom1 A T 19: 8,905,471 (GRCm39) H236Q possibly damaging Het
Secisbp2 T C 13: 51,819,352 (GRCm39) S311P probably benign Het
Slc26a1 T C 5: 108,820,182 (GRCm39) D355G probably benign Het
Slc28a3 C T 13: 58,707,077 (GRCm39) A574T probably damaging Het
Sox11 A G 12: 27,392,313 (GRCm39) V32A possibly damaging Het
Spata17 T C 1: 186,915,436 (GRCm39) Y107C probably damaging Het
Speer1a C A 5: 11,394,205 (GRCm39) Y104* probably null Het
Stxbp5l T C 16: 37,024,814 (GRCm39) T595A probably benign Het
Syt11 T C 3: 88,655,149 (GRCm39) D78G probably damaging Het
Tatdn2 T G 6: 113,684,348 (GRCm39) I674S probably damaging Het
Tex14 T A 11: 87,383,878 (GRCm39) S189R probably benign Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Tor3a T C 1: 156,483,373 (GRCm39) T350A probably benign Het
Vmn1r129 A T 7: 21,095,205 (GRCm39) H4Q probably null Het
Vmn1r32 A G 6: 66,530,623 (GRCm39) M51T possibly damaging Het
Zfp141 T C 7: 42,125,687 (GRCm39) T262A possibly damaging Het
Zfp980 T A 4: 145,427,596 (GRCm39) N108K probably benign Het
Other mutations in Ttr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02074:Ttr APN 18 20,799,580 (GRCm39) missense probably benign 0.00
Quid_pro_quo UTSW 18 20,806,692 (GRCm39) missense possibly damaging 0.73
transactional UTSW 18 20,803,102 (GRCm39) nonsense probably null
R0709:Ttr UTSW 18 20,803,034 (GRCm39) critical splice acceptor site probably null
R5133:Ttr UTSW 18 20,803,167 (GRCm39) missense possibly damaging 0.46
R5979:Ttr UTSW 18 20,803,059 (GRCm39) missense probably damaging 1.00
R6239:Ttr UTSW 18 20,806,692 (GRCm39) missense possibly damaging 0.73
R7546:Ttr UTSW 18 20,803,102 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCAGAAACTGTTCTTGCTTTG -3'
(R):5'- TGTGTGTCTGAATCTAACACGA -3'

Sequencing Primer
(F):5'- CAATGCTGTCTATGTCATACTGG -3'
(R):5'- GTCTGAATCTAACACGAATAAGAGC -3'
Posted On 2021-07-15