Incidental Mutation 'R8834:Olfr23'
ID674042
Institutional Source Beutler Lab
Gene Symbol Olfr23
Ensembl Gene ENSMUSG00000069816
Gene Nameolfactory receptor 23
SynonymsMTPCR50, MOR135-27, GA_x6K02T2P1NL-4097159-4098136
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R8834 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location73936677-73942658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73940338 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 31 (F31L)
Ref Sequence ENSEMBL: ENSMUSP00000150593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092917] [ENSMUST00000214210]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092917
AA Change: F31L

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090596
Gene: ENSMUSG00000069816
AA Change: F31L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.8e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.8e-6 PFAM
Pfam:7tm_1 41 290 9.3e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214210
AA Change: F31L

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,278,149 T1007A probably benign Het
Adcy6 A G 15: 98,601,041 L293P possibly damaging Het
Cacna2d1 T A 5: 16,266,737 V260E possibly damaging Het
Capn3 T A 2: 120,464,053 F61I probably damaging Het
Cdh9 A G 15: 16,850,878 S578G probably damaging Het
Cog4 A G 8: 110,881,417 Y714C probably damaging Het
Dnah14 T G 1: 181,616,750 F542V possibly damaging Het
Dock8 T C 19: 25,163,470 V1350A probably benign Het
Fat3 C T 9: 16,031,197 G1293E probably damaging Het
Fnip1 T C 11: 54,504,755 V985A possibly damaging Het
Frem1 T C 4: 83,004,373 D397G probably damaging Het
Gan C G 8: 117,158,292 P53R Het
Gcc2 T C 10: 58,286,045 probably null Het
Glb1l2 C T 9: 26,778,018 probably null Het
Gm973 T C 1: 59,524,661 F2L Het
Heatr5a A G 12: 51,909,956 probably null Het
Kifc2 T A 15: 76,667,050 H681Q probably damaging Het
Krt16 T A 11: 100,248,410 S161C probably damaging Het
Lrrc3b A G 14: 15,358,562 C15R possibly damaging Het
Lrrc66 C G 5: 73,608,585 A372P possibly damaging Het
Ly75 C T 2: 60,331,089 R884H probably benign Het
Map2k6 T A 11: 110,492,593 C109* probably null Het
Mapk9 C T 11: 49,883,183 S389L probably damaging Het
Mier2 C T 10: 79,550,459 G57D unknown Het
Mis18bp1 A T 12: 65,161,645 M98K probably benign Het
Mkl1 A G 15: 81,020,310 L196P probably benign Het
Pcsk7 A G 9: 45,919,291 S456G possibly damaging Het
Phf12 T A 11: 78,006,782 C102S probably damaging Het
Ppm1k A G 6: 57,525,038 C47R probably benign Het
Rgs10 A G 7: 128,389,085 I93T probably damaging Het
Ror2 CCCTCCTCCTCCTCCTC CCCTCCTCCTCCTC 13: 53,110,302 probably benign Het
Rusc2 T A 4: 43,416,431 F579Y possibly damaging Het
Selplg G A 5: 113,819,630 S205L possibly damaging Het
Sh3gl3 T C 7: 82,306,791 V109A possibly damaging Het
Tanc2 T C 11: 105,917,019 S336P Het
Tlr2 C A 3: 83,838,713 R21L probably benign Het
Trpa1 C T 1: 14,893,304 V565I possibly damaging Het
Ubqln1 A T 13: 58,183,244 S390T probably damaging Het
Ubr3 T C 2: 70,003,441 V1514A probably benign Het
Uchl5 A T 1: 143,786,230 K81* probably null Het
Unc13b T C 4: 43,175,954 F2261L unknown Het
Usp12 T A 5: 146,754,517 E142D probably benign Het
V1ra8 A T 6: 90,203,640 D275V unknown Het
Zfp804a A G 2: 82,259,097 H1090R possibly damaging Het
Other mutations in Olfr23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr23 APN 11 73941194 missense probably benign
IGL02290:Olfr23 APN 11 73940869 missense probably benign 0.00
IGL02301:Olfr23 APN 11 73941068 missense possibly damaging 0.79
IGL02303:Olfr23 APN 11 73940450 missense possibly damaging 0.87
IGL02510:Olfr23 APN 11 73941005 missense probably damaging 1.00
IGL02558:Olfr23 APN 11 73940825 missense probably benign 0.01
IGL02712:Olfr23 APN 11 73940930 missense probably benign 0.12
IGL02795:Olfr23 APN 11 73940929 missense probably benign 0.05
IGL02800:Olfr23 APN 11 73941116 missense probably damaging 1.00
IGL03350:Olfr23 APN 11 73940838 missense probably damaging 0.99
R0277:Olfr23 UTSW 11 73940947 missense probably benign 0.28
R0323:Olfr23 UTSW 11 73940947 missense probably benign 0.28
R0333:Olfr23 UTSW 11 73940767 missense possibly damaging 0.78
R0389:Olfr23 UTSW 11 73941053 missense probably benign 0.12
R0391:Olfr23 UTSW 11 73941109 missense probably damaging 1.00
R0723:Olfr23 UTSW 11 73940270 missense probably benign 0.00
R1469:Olfr23 UTSW 11 73940557 missense probably benign 0.05
R1469:Olfr23 UTSW 11 73940557 missense probably benign 0.05
R1900:Olfr23 UTSW 11 73940660 missense possibly damaging 0.79
R2363:Olfr23 UTSW 11 73940356 missense possibly damaging 0.96
R4236:Olfr23 UTSW 11 73940356 missense possibly damaging 0.96
R4630:Olfr23 UTSW 11 73940996 missense probably damaging 1.00
R4717:Olfr23 UTSW 11 73940815 missense possibly damaging 0.86
R4801:Olfr23 UTSW 11 73940870 missense possibly damaging 0.88
R4802:Olfr23 UTSW 11 73940870 missense possibly damaging 0.88
R4964:Olfr23 UTSW 11 73941202 missense probably benign 0.04
R5119:Olfr23 UTSW 11 73940552 missense possibly damaging 0.76
R5470:Olfr23 UTSW 11 73940870 missense probably benign 0.06
R6196:Olfr23 UTSW 11 73940809 missense possibly damaging 0.86
R6551:Olfr23 UTSW 11 73940303 missense probably benign 0.11
R7695:Olfr23 UTSW 11 73940894 missense possibly damaging 0.94
R7979:Olfr23 UTSW 11 73940575 missense probably benign 0.00
R8074:Olfr23 UTSW 11 73940387 missense possibly damaging 0.78
X0065:Olfr23 UTSW 11 73940324 missense possibly damaging 0.59
Z1088:Olfr23 UTSW 11 73941138 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCCCTTGTCTTACGTATATGTTC -3'
(R):5'- TAACGGTCATAGGCCATGGC -3'

Sequencing Primer
(F):5'- AAACTGTCATCTCCCGGT -3'
(R):5'- TACATTTGTGCAAGGCAGCC -3'
Posted On2021-07-15