Incidental Mutation 'R8834:Ror2'
ID 674049
Institutional Source Beutler Lab
Gene Symbol Ror2
Ensembl Gene ENSMUSG00000021464
Gene Name receptor tyrosine kinase-like orphan receptor 2
Synonyms Ntrkr2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8834 (G1)
Quality Score 125.467
Status Validated
Chromosome 13
Chromosomal Location 53109312-53286124 bp(-) (GRCm38)
Type of Mutation small deletion (1 aa in frame mutation)
DNA Base Change (assembly) CCCTCCTCCTCCTCCTC to CCCTCCTCCTCCTC at 53110302 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000021918
SMART Domains Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IGc2 74 142 5.23e-16 SMART
Pfam:Fz 174 294 1.2e-12 PFAM
KR 314 396 3.94e-45 SMART
transmembrane domain 403 425 N/A INTRINSIC
TyrKc 473 746 1.96e-113 SMART
low complexity region 765 783 N/A INTRINSIC
low complexity region 788 801 N/A INTRINSIC
low complexity region 839 859 N/A INTRINSIC
low complexity region 860 872 N/A INTRINSIC
low complexity region 905 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130235
SMART Domains Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464

DomainStartEndE-ValueType
IGc2 62 130 5.23e-16 SMART
Pfam:Fz 162 289 3.2e-26 PFAM
KR 302 384 3.94e-45 SMART
transmembrane domain 391 413 N/A INTRINSIC
TyrKc 461 734 1.96e-113 SMART
low complexity region 753 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,278,149 T1007A probably benign Het
Adcy6 A G 15: 98,601,041 L293P possibly damaging Het
Cacna2d1 T A 5: 16,266,737 V260E possibly damaging Het
Capn3 T A 2: 120,464,053 F61I probably damaging Het
Cdh9 A G 15: 16,850,878 S578G probably damaging Het
Cog4 A G 8: 110,881,417 Y714C probably damaging Het
Dnah14 T G 1: 181,616,750 F542V possibly damaging Het
Dock8 T C 19: 25,163,470 V1350A probably benign Het
Eps8 A G 6: 137,527,308 probably benign Het
Fat3 C T 9: 16,031,197 G1293E probably damaging Het
Fnip1 T C 11: 54,504,755 V985A possibly damaging Het
Frem1 T C 4: 83,004,373 D397G probably damaging Het
Gan C G 8: 117,158,292 P53R Het
Gcc2 T C 10: 58,286,045 probably null Het
Glb1l2 C T 9: 26,778,018 probably null Het
Gm973 T C 1: 59,524,661 F2L Het
Heatr5a A G 12: 51,909,956 probably null Het
Kifc2 T A 15: 76,667,050 H681Q probably damaging Het
Krt16 T A 11: 100,248,410 S161C probably damaging Het
Lrrc3b A G 14: 15,358,562 C15R possibly damaging Het
Lrrc66 C G 5: 73,608,585 A372P possibly damaging Het
Ly75 C T 2: 60,331,089 R884H probably benign Het
Map2k6 T A 11: 110,492,593 C109* probably null Het
Mapk9 C T 11: 49,883,183 S389L probably damaging Het
Mier2 C T 10: 79,550,459 G57D unknown Het
Mis18bp1 A T 12: 65,161,645 M98K probably benign Het
Mkl1 A G 15: 81,020,310 L196P probably benign Het
Olfr23 T C 11: 73,940,338 F31L possibly damaging Het
Pcsk7 A G 9: 45,919,291 S456G possibly damaging Het
Phf12 T A 11: 78,006,782 C102S probably damaging Het
Ppm1k A G 6: 57,525,038 C47R probably benign Het
Rgs10 A G 7: 128,389,085 I93T probably damaging Het
Rusc2 T A 4: 43,416,431 F579Y possibly damaging Het
Selplg G A 5: 113,819,630 S205L possibly damaging Het
Sh3gl3 T C 7: 82,306,791 V109A possibly damaging Het
Tanc2 T C 11: 105,917,019 S336P Het
Tlr2 C A 3: 83,838,713 R21L probably benign Het
Trpa1 C T 1: 14,893,304 V565I possibly damaging Het
Ubqln1 A T 13: 58,183,244 S390T probably damaging Het
Ubr3 T C 2: 70,003,441 V1514A probably benign Het
Uchl5 A T 1: 143,786,230 K81* probably null Het
Unc13b T C 4: 43,175,954 F2261L unknown Het
Usp12 T A 5: 146,754,517 E142D probably benign Het
V1ra8 A T 6: 90,203,640 D275V unknown Het
Zfp804a A G 2: 82,259,097 H1090R possibly damaging Het
Other mutations in Ror2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ror2 APN 13 53113082 missense probably benign 0.01
IGL01523:Ror2 APN 13 53118963 missense probably benign 0.02
IGL01599:Ror2 APN 13 53111617 missense probably damaging 1.00
IGL01669:Ror2 APN 13 53111088 missense probably damaging 1.00
IGL02016:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02138:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02139:Ror2 APN 13 53111164 missense probably damaging 1.00
IGL02172:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02173:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02176:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02177:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02178:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02179:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02182:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02189:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02190:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02203:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02230:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02231:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02234:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02423:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02424:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02478:Ror2 APN 13 53121667 missense probably damaging 1.00
IGL02479:Ror2 APN 13 53131932 missense possibly damaging 0.62
IGL02517:Ror2 APN 13 53118840 missense probably damaging 1.00
IGL02554:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02618:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02619:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02622:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02623:Ror2 APN 13 53110728 missense probably damaging 1.00
lavage UTSW 13 53118982 missense probably damaging 1.00
tendrils UTSW 13 53111451 missense probably damaging 0.96
willowy UTSW 13 53131919 missense probably damaging 1.00
R0076:Ror2 UTSW 13 53113074 missense probably benign 0.02
R0375:Ror2 UTSW 13 53132004 missense probably damaging 1.00
R0826:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R1823:Ror2 UTSW 13 53110305 missense probably benign 0.07
R1895:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1946:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1983:Ror2 UTSW 13 53110408 missense probably benign 0.01
R2031:Ror2 UTSW 13 53117330 missense probably benign 0.01
R2197:Ror2 UTSW 13 53285780 critical splice donor site probably null
R2246:Ror2 UTSW 13 53111602 missense probably damaging 1.00
R2405:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2411:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2905:Ror2 UTSW 13 53131995 missense probably benign 0.01
R3156:Ror2 UTSW 13 53117364 missense probably damaging 0.98
R4198:Ror2 UTSW 13 53110644 missense probably benign 0.08
R4408:Ror2 UTSW 13 53118961 missense probably damaging 1.00
R4469:Ror2 UTSW 13 53131980 missense possibly damaging 0.87
R4648:Ror2 UTSW 13 53285500 nonsense probably null
R4705:Ror2 UTSW 13 53117297 missense probably benign 0.00
R4824:Ror2 UTSW 13 53110683 missense probably benign 0.10
R4831:Ror2 UTSW 13 53118844 missense probably damaging 0.97
R4951:Ror2 UTSW 13 53117147 missense probably benign 0.00
R4975:Ror2 UTSW 13 53131918 missense probably damaging 1.00
R5380:Ror2 UTSW 13 53117149 missense possibly damaging 0.73
R5469:Ror2 UTSW 13 53117339 missense probably benign 0.00
R5604:Ror2 UTSW 13 53117165 missense probably benign 0.01
R6188:Ror2 UTSW 13 53111311 missense probably damaging 0.98
R6221:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R6243:Ror2 UTSW 13 53113080 missense probably benign
R6255:Ror2 UTSW 13 53110542 missense probably damaging 1.00
R6497:Ror2 UTSW 13 53131919 missense probably damaging 1.00
R6717:Ror2 UTSW 13 53118982 missense probably damaging 1.00
R6918:Ror2 UTSW 13 53111451 missense probably damaging 0.96
R7092:Ror2 UTSW 13 53110236 missense probably benign
R7134:Ror2 UTSW 13 53146706 missense probably benign 0.00
R7254:Ror2 UTSW 13 53118720 missense possibly damaging 0.72
R7517:Ror2 UTSW 13 53110865 missense possibly damaging 0.86
R7560:Ror2 UTSW 13 53110813 missense probably benign 0.05
R7746:Ror2 UTSW 13 53117225 missense probably damaging 1.00
R8031:Ror2 UTSW 13 53113157 missense probably damaging 1.00
R8479:Ror2 UTSW 13 53117364 missense probably damaging 0.98
R8684:Ror2 UTSW 13 53110266 missense possibly damaging 0.90
R8948:Ror2 UTSW 13 53131996 missense possibly damaging 0.67
R9233:Ror2 UTSW 13 53111554 missense probably benign
R9234:Ror2 UTSW 13 53111338 missense probably damaging 1.00
R9573:Ror2 UTSW 13 53111431 missense not run
Predicted Primers PCR Primer
(F):5'- TCAGGTGGGTAGGCTCAAAC -3'
(R):5'- TCCAGATCCCCATGCAGATG -3'

Sequencing Primer
(F):5'- CCCTGGGCTCTGGTGATG -3'
(R):5'- ATGCAGATGGCCCCACAG -3'
Posted On 2021-07-15