Incidental Mutation 'R8835:Dpysl5'
ID 674076
Institutional Source Beutler Lab
Gene Symbol Dpysl5
Ensembl Gene ENSMUSG00000029168
Gene Name dihydropyrimidinase-like 5
Synonyms CRMP-5, Crmp5, CRAM
MMRRC Submission 068663-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.234) question?
Stock # R8835 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 30868908-30956713 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 30936282 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000085400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088081] [ENSMUST00000114729]
AlphaFold Q9EQF6
Predicted Effect probably null
Transcript: ENSMUST00000088081
SMART Domains Protein: ENSMUSP00000085400
Gene: ENSMUSG00000029168

DomainStartEndE-ValueType
Pfam:Amidohydro_5 28 97 3.4e-11 PFAM
Pfam:Amidohydro_4 52 403 4.3e-17 PFAM
Pfam:Amidohydro_1 57 406 2.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114729
SMART Domains Protein: ENSMUSP00000110377
Gene: ENSMUSG00000029168

DomainStartEndE-ValueType
Pfam:Amidohydro_1 57 446 1.1e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CRMP (collapsing response mediator protein) family thought to be involved in neural development. Antibodies to the encoded protein were found in some patients with neurologic symptoms who had paraneoplastic syndrome. A pseudogene of this gene is found on chromosome 11. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, abnormal Purkinje morphology, absent long term depression, and no response to BDNF. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G C 3: 121,896,433 (GRCm39) G555A probably benign Het
Afmid A G 11: 117,718,914 (GRCm39) K15E probably benign Het
Ankfn1 T C 11: 89,429,379 (GRCm39) I2V probably benign Het
Arhgap21 A T 2: 20,972,144 (GRCm39) C26* probably null Het
Arhgef38 A T 3: 132,837,832 (GRCm39) D699E unknown Het
Atxn2 T C 5: 121,940,248 (GRCm39) S1008P possibly damaging Het
C1rb A G 6: 124,552,217 (GRCm39) K312E probably benign Het
Cc2d1b G A 4: 108,484,264 (GRCm39) R424Q probably damaging Het
Ccdc27 G A 4: 154,127,023 (GRCm39) T13I unknown Het
Cdc42bpa G T 1: 179,896,916 (GRCm39) V400F probably damaging Het
Cemip C A 7: 83,586,651 (GRCm39) G1301V probably damaging Het
Cep170 A G 1: 176,584,429 (GRCm39) L650P probably benign Het
Cfap100 T A 6: 90,386,597 (GRCm39) D222V Het
Cog8 A T 8: 107,773,920 (GRCm39) probably benign Het
Col4a4 A G 1: 82,447,313 (GRCm39) L1279P unknown Het
Cyyr1 A T 16: 85,254,553 (GRCm39) Y116* probably null Het
Dlgap4 A T 2: 156,587,946 (GRCm39) S597C probably damaging Het
Dtl G T 1: 191,293,609 (GRCm39) H189Q probably damaging Het
Epha1 A T 6: 42,342,723 (GRCm39) N275K probably benign Het
Fbxo11 A G 17: 88,321,874 (GRCm39) C110R Het
Fhod1 A G 8: 106,065,484 (GRCm39) probably null Het
Fndc1 A C 17: 7,958,111 (GRCm39) F1712C probably damaging Het
Gcnt7 G A 2: 172,295,957 (GRCm39) T289M probably damaging Het
Gm11020 A T 8: 105,048,293 (GRCm39) E32V probably null Het
Hoxb1 C T 11: 96,256,627 (GRCm39) probably benign Het
Ibtk G A 9: 85,619,563 (GRCm39) L126F possibly damaging Het
Il17rb T G 14: 29,722,308 (GRCm39) E241A possibly damaging Het
Kdm3b G A 18: 34,941,802 (GRCm39) R631Q probably damaging Het
Lnpep A T 17: 17,750,118 (GRCm39) S991T possibly damaging Het
Mctp2 T G 7: 71,852,161 (GRCm39) E455A probably benign Het
Mgat4a A T 1: 37,491,372 (GRCm39) I421N possibly damaging Het
Myof C A 19: 37,955,547 (GRCm39) V526L possibly damaging Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Nav2 G A 7: 49,248,551 (GRCm39) G2297D possibly damaging Het
Nipa2 A T 7: 55,583,307 (GRCm39) probably benign Het
Nkx6-1 G T 5: 101,811,971 (GRCm39) P44T unknown Het
Nploc4 T C 11: 120,309,122 (GRCm39) K160R possibly damaging Het
Olfm3 C A 3: 114,916,061 (GRCm39) A331D probably damaging Het
Or10g6 A C 9: 39,934,171 (GRCm39) S161R possibly damaging Het
Or1e33 T A 11: 73,738,702 (GRCm39) H83L probably benign Het
Or52s1 T A 7: 102,861,928 (GRCm39) I287K probably damaging Het
Otof T C 5: 30,528,264 (GRCm39) N1898S probably benign Het
Pde1a G A 2: 79,708,522 (GRCm39) L299F probably damaging Het
Pole T C 5: 110,454,775 (GRCm39) Y1003H probably damaging Het
Ppl C G 16: 4,906,854 (GRCm39) R1147P probably damaging Het
Prom1 T G 5: 44,175,722 (GRCm39) Y533S probably damaging Het
Prrt4 C A 6: 29,169,986 (GRCm39) C822F probably damaging Het
Prss12 A C 3: 123,285,201 (GRCm39) D542A possibly damaging Het
Ptrh2 T C 11: 86,580,412 (GRCm39) Y10H probably damaging Het
Pum1 C T 4: 130,471,064 (GRCm39) T439M probably damaging Het
Rarb A T 14: 16,575,011 (GRCm38) F2I probably benign Het
Rpp21 G A 17: 36,566,678 (GRCm39) S127L probably benign Het
Scgb1b19 T G 7: 32,986,948 (GRCm39) V33G probably damaging Het
Smc1b A T 15: 85,013,949 (GRCm39) V74D possibly damaging Het
Spint3 T A 2: 164,411,923 (GRCm39) K29* probably null Het
Spns1 G A 7: 125,971,593 (GRCm39) S319F possibly damaging Het
Tacc2 T A 7: 130,228,258 (GRCm39) W1648R probably benign Het
Tbc1d21 C G 9: 58,273,991 (GRCm39) V62L probably damaging Het
Tectb A G 19: 55,172,270 (GRCm39) N130S probably benign Het
Tln2 A T 9: 67,304,975 (GRCm39) probably benign Het
Tmem135 G C 7: 88,797,186 (GRCm39) L357V probably benign Het
Tpd52l1 G T 10: 31,255,314 (GRCm39) T11K probably benign Het
Ttll10 G T 4: 156,133,055 (GRCm39) P10T probably benign Het
Vmn1r215 A G 13: 23,260,409 (GRCm39) I150V possibly damaging Het
Zdhhc11 T A 13: 74,127,411 (GRCm39) Y263N probably damaging Het
Zfp354a C T 11: 50,960,628 (GRCm39) R279* probably null Het
Zfp715 A G 7: 42,948,430 (GRCm39) I510T Het
Zfp735 A T 11: 73,601,692 (GRCm39) H212L possibly damaging Het
Zfpm1 A G 8: 123,063,772 (GRCm39) T944A unknown Het
Other mutations in Dpysl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02177:Dpysl5 APN 5 30,902,622 (GRCm39) missense probably damaging 1.00
IGL02277:Dpysl5 APN 5 30,946,125 (GRCm39) missense probably damaging 1.00
R0517:Dpysl5 UTSW 5 30,935,410 (GRCm39) missense probably damaging 0.99
R0788:Dpysl5 UTSW 5 30,946,185 (GRCm39) critical splice donor site probably null
R1716:Dpysl5 UTSW 5 30,935,338 (GRCm39) missense probably benign 0.00
R2016:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R2208:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R2211:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R2965:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R4440:Dpysl5 UTSW 5 30,949,612 (GRCm39) missense probably damaging 0.99
R4863:Dpysl5 UTSW 5 30,941,687 (GRCm39) missense probably benign 0.08
R4918:Dpysl5 UTSW 5 30,949,612 (GRCm39) missense probably damaging 1.00
R5377:Dpysl5 UTSW 5 30,948,857 (GRCm39) missense probably damaging 1.00
R6379:Dpysl5 UTSW 5 30,935,317 (GRCm39) critical splice acceptor site probably null
R6621:Dpysl5 UTSW 5 30,941,813 (GRCm39) critical splice donor site probably null
R7199:Dpysl5 UTSW 5 30,940,539 (GRCm39) missense probably benign 0.21
R7232:Dpysl5 UTSW 5 30,949,642 (GRCm39) missense probably benign 0.03
R7388:Dpysl5 UTSW 5 30,902,805 (GRCm39) missense probably benign
R7446:Dpysl5 UTSW 5 30,936,231 (GRCm39) missense probably benign 0.00
R7868:Dpysl5 UTSW 5 30,902,760 (GRCm39) missense probably damaging 1.00
R8041:Dpysl5 UTSW 5 30,953,658 (GRCm39) missense probably benign 0.28
R8428:Dpysl5 UTSW 5 30,902,811 (GRCm39) missense probably damaging 0.99
R8888:Dpysl5 UTSW 5 30,902,687 (GRCm39) missense probably benign 0.01
R8943:Dpysl5 UTSW 5 30,935,375 (GRCm39) missense probably benign 0.33
R9033:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R9139:Dpysl5 UTSW 5 30,935,397 (GRCm39) missense probably benign 0.45
R9305:Dpysl5 UTSW 5 30,948,959 (GRCm39) missense probably damaging 1.00
R9522:Dpysl5 UTSW 5 30,935,399 (GRCm39) nonsense probably null
R9700:Dpysl5 UTSW 5 30,904,417 (GRCm39) nonsense probably null
Z1176:Dpysl5 UTSW 5 30,935,464 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGCACAGTCCTTAAGAAATATGAAG -3'
(R):5'- GCCCAATGTGAACGTTGAAACTG -3'

Sequencing Primer
(F):5'- CCTCCTTTGGAAAATGTACACTGCAG -3'
(R):5'- CGTTGAAACTGTAGGTATGAGC -3'
Posted On 2021-07-15