Incidental Mutation 'R8835:Pole'
ID 674079
Institutional Source Beutler Lab
Gene Symbol Pole
Ensembl Gene ENSMUSG00000007080
Gene Name polymerase (DNA directed), epsilon
Synonyms pol-epsilon
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8835 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 110286306-110337474 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110306909 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1003 (Y1003H)
Ref Sequence ENSEMBL: ENSMUSP00000007296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007296]
AlphaFold Q9WVF7
Predicted Effect probably damaging
Transcript: ENSMUST00000007296
AA Change: Y1003H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: Y1003H

DomainStartEndE-ValueType
POLBc 267 870 9.42e-97 SMART
Blast:POLBc 903 970 1e-28 BLAST
Blast:POLBc 1014 1073 2e-22 BLAST
Blast:POLBc 1195 1266 7e-21 BLAST
low complexity region 1275 1294 N/A INTRINSIC
Blast:DUF1744 1401 1430 2e-7 BLAST
DUF1744 1524 1924 1.9e-236 SMART
coiled coil region 1936 1963 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G C 3: 122,102,784 G555A probably benign Het
Afmid A G 11: 117,828,088 K15E probably benign Het
Ankfn1 T C 11: 89,538,553 I2V probably benign Het
Arhgap21 A T 2: 20,967,333 C26* probably null Het
Arhgef38 A T 3: 133,132,071 D699E unknown Het
Atxn2 T C 5: 121,802,185 S1008P possibly damaging Het
C1rb A G 6: 124,575,258 K312E probably benign Het
Cc2d1b G A 4: 108,627,067 R424Q probably damaging Het
Ccdc27 G A 4: 154,042,566 T13I unknown Het
Cdc42bpa G T 1: 180,069,351 V400F probably damaging Het
Cemip C A 7: 83,937,443 G1301V probably damaging Het
Cep170 A G 1: 176,756,863 L650P probably benign Het
Cfap100 T A 6: 90,409,615 D222V Het
Cog8 A T 8: 107,047,288 probably benign Het
Col4a4 A G 1: 82,469,592 L1279P unknown Het
Cyyr1 A T 16: 85,457,665 Y116* probably null Het
Dlgap4 A T 2: 156,746,026 S597C probably damaging Het
Dpysl5 T A 5: 30,778,938 probably null Het
Dtl G T 1: 191,561,497 H189Q probably damaging Het
Epha1 A T 6: 42,365,789 N275K probably benign Het
Fbxo11 A G 17: 88,014,446 C110R Het
Fhod1 A G 8: 105,338,852 probably null Het
Fndc1 A C 17: 7,739,279 F1712C probably damaging Het
Gcnt7 G A 2: 172,454,037 T289M probably damaging Het
Gm11020 A T 8: 104,321,661 E32V probably null Het
Hoxb1 C T 11: 96,365,801 probably benign Het
Ibtk G A 9: 85,737,510 L126F possibly damaging Het
Il17rb T G 14: 30,000,351 E241A possibly damaging Het
Kdm3b G A 18: 34,808,749 R631Q probably damaging Het
Lnpep A T 17: 17,529,856 S991T possibly damaging Het
Mctp2 T G 7: 72,202,413 E455A probably benign Het
Mgat4a A T 1: 37,452,291 I421N possibly damaging Het
Myof C A 19: 37,967,099 V526L possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nav2 G A 7: 49,598,803 G2297D possibly damaging Het
Nipa2 A T 7: 55,933,559 probably benign Het
Nkx6-1 G T 5: 101,664,105 P44T unknown Het
Nploc4 T C 11: 120,418,296 K160R possibly damaging Het
Olfm3 C A 3: 115,122,412 A331D probably damaging Het
Olfr393 T A 11: 73,847,876 H83L probably benign Het
Olfr593 T A 7: 103,212,721 I287K probably damaging Het
Olfr981 A C 9: 40,022,875 S161R possibly damaging Het
Otof T C 5: 30,370,920 N1898S probably benign Het
Pde1a G A 2: 79,878,178 L299F probably damaging Het
Ppl C G 16: 5,088,990 R1147P probably damaging Het
Prom1 T G 5: 44,018,380 Y533S probably damaging Het
Prrt4 C A 6: 29,169,987 C822F probably damaging Het
Prss12 A C 3: 123,491,552 D542A possibly damaging Het
Ptrh2 T C 11: 86,689,586 Y10H probably damaging Het
Pum1 C T 4: 130,743,753 T439M probably damaging Het
Rarb A T 14: 16,575,011 F2I probably benign Het
Rpp21 G A 17: 36,255,786 S127L probably benign Het
Scgb1b19 T G 7: 33,287,523 V33G probably damaging Het
Smc1b A T 15: 85,129,748 V74D possibly damaging Het
Spint3 T A 2: 164,570,003 K29* probably null Het
Spns1 G A 7: 126,372,421 S319F possibly damaging Het
Tacc2 T A 7: 130,626,528 W1648R probably benign Het
Tbc1d21 C G 9: 58,366,708 V62L probably damaging Het
Tectb A G 19: 55,183,838 N130S probably benign Het
Tln2 A T 9: 67,397,693 probably benign Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tpd52l1 G T 10: 31,379,318 T11K probably benign Het
Ttll10 G T 4: 156,048,598 P10T probably benign Het
Vmn1r215 A G 13: 23,076,239 I150V possibly damaging Het
Zdhhc11 T A 13: 73,979,292 Y263N probably damaging Het
Zfp354a C T 11: 51,069,801 R279* probably null Het
Zfp715 A G 7: 43,299,006 I510T Het
Zfp735 A T 11: 73,710,866 H212L possibly damaging Het
Zfpm1 A G 8: 122,337,033 T944A unknown Het
Other mutations in Pole
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pole APN 5 110303565 splice site probably benign
IGL00475:Pole APN 5 110291096 nonsense probably null
IGL00837:Pole APN 5 110302009 missense possibly damaging 0.91
IGL00976:Pole APN 5 110323572 missense probably benign 0.00
IGL01081:Pole APN 5 110337240 missense possibly damaging 0.92
IGL01503:Pole APN 5 110303884 missense probably damaging 1.00
IGL01640:Pole APN 5 110298266 missense probably null 0.08
IGL01987:Pole APN 5 110337232 missense probably benign 0.01
IGL02429:Pole APN 5 110299800 missense probably benign
IGL02733:Pole APN 5 110312728 splice site probably benign
IGL03102:Pole APN 5 110297073 missense probably damaging 1.00
IGL03157:Pole APN 5 110293753 missense probably benign
IGL03186:Pole APN 5 110299920 critical splice donor site probably null
IGL03271:Pole APN 5 110318319 missense probably benign
IGL03351:Pole APN 5 110301998 splice site probably benign
IGL03408:Pole APN 5 110294560 missense probably damaging 1.00
IGL03410:Pole APN 5 110324559 missense probably benign
ANU74:Pole UTSW 5 110289370 missense probably benign 0.44
PIT4495001:Pole UTSW 5 110303914 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0124:Pole UTSW 5 110303992 missense probably damaging 0.96
R0145:Pole UTSW 5 110324425 missense probably damaging 0.99
R0523:Pole UTSW 5 110303593 missense probably damaging 0.96
R0590:Pole UTSW 5 110317926 missense probably benign
R0625:Pole UTSW 5 110325550 missense possibly damaging 0.50
R0707:Pole UTSW 5 110298988 missense probably damaging 1.00
R1160:Pole UTSW 5 110295253 missense possibly damaging 0.85
R1320:Pole UTSW 5 110309129 frame shift probably null
R1384:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1626:Pole UTSW 5 110293369 missense probably benign 0.25
R1643:Pole UTSW 5 110317845 missense probably damaging 1.00
R1655:Pole UTSW 5 110335922 missense probably damaging 1.00
R1668:Pole UTSW 5 110297369 missense probably damaging 1.00
R1783:Pole UTSW 5 110297430 missense probably damaging 1.00
R1843:Pole UTSW 5 110330835 critical splice donor site probably null
R1853:Pole UTSW 5 110306853 missense possibly damaging 0.95
R1867:Pole UTSW 5 110334197 missense probably benign 0.08
R1874:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1891:Pole UTSW 5 110332542 missense probably damaging 1.00
R1928:Pole UTSW 5 110327778 missense probably benign
R2073:Pole UTSW 5 110325551 missense probably damaging 0.99
R2341:Pole UTSW 5 110330963 missense possibly damaging 0.67
R2448:Pole UTSW 5 110297092 missense probably damaging 1.00
R2504:Pole UTSW 5 110290502 splice site probably null
R3053:Pole UTSW 5 110289795 missense probably damaging 1.00
R3892:Pole UTSW 5 110336439 missense probably damaging 1.00
R3964:Pole UTSW 5 110312782 missense probably damaging 1.00
R3965:Pole UTSW 5 110312782 missense probably damaging 1.00
R4374:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4376:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4377:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4520:Pole UTSW 5 110297924 missense probably damaging 1.00
R4670:Pole UTSW 5 110306387 missense probably benign 0.01
R4778:Pole UTSW 5 110330832 missense probably benign 0.00
R4887:Pole UTSW 5 110324753 missense probably damaging 0.99
R4898:Pole UTSW 5 110290224 critical splice acceptor site probably null
R5184:Pole UTSW 5 110294934 missense possibly damaging 0.91
R5359:Pole UTSW 5 110332488 missense probably benign 0.03
R5483:Pole UTSW 5 110294568 missense probably damaging 1.00
R5529:Pole UTSW 5 110332466 missense probably benign 0.20
R5576:Pole UTSW 5 110312065 nonsense probably null
R5817:Pole UTSW 5 110312972 missense probably damaging 1.00
R5877:Pole UTSW 5 110332463 missense probably benign
R5956:Pole UTSW 5 110337287 unclassified probably benign
R5990:Pole UTSW 5 110302144 missense probably damaging 1.00
R6019:Pole UTSW 5 110324514 missense probably benign 0.01
R6019:Pole UTSW 5 110324515 missense probably benign 0.01
R6093:Pole UTSW 5 110312090 missense probably benign 0.01
R6376:Pole UTSW 5 110336374 missense probably damaging 0.99
R6494:Pole UTSW 5 110324722 missense possibly damaging 0.86
R6535:Pole UTSW 5 110324807 missense probably damaging 1.00
R6723:Pole UTSW 5 110323616 missense probably benign 0.11
R6757:Pole UTSW 5 110303610 missense probably damaging 1.00
R6930:Pole UTSW 5 110293290 missense probably benign 0.01
R6988:Pole UTSW 5 110329583 missense probably damaging 0.97
R6992:Pole UTSW 5 110332499 missense probably damaging 0.99
R7067:Pole UTSW 5 110334218 missense probably damaging 1.00
R7097:Pole UTSW 5 110325102 splice site probably null
R7122:Pole UTSW 5 110325102 splice site probably null
R7202:Pole UTSW 5 110297107 missense possibly damaging 0.94
R7340:Pole UTSW 5 110334464 missense probably benign 0.06
R7345:Pole UTSW 5 110303903 missense possibly damaging 0.82
R7509:Pole UTSW 5 110330705 start gained probably benign
R7557:Pole UTSW 5 110312994 missense probably damaging 1.00
R7740:Pole UTSW 5 110331041 missense probably benign 0.00
R7792:Pole UTSW 5 110297466 splice site probably null
R7832:Pole UTSW 5 110317797 missense probably benign 0.00
R7849:Pole UTSW 5 110332548 missense probably benign 0.04
R7852:Pole UTSW 5 110306829 missense probably damaging 1.00
R7960:Pole UTSW 5 110289861 missense possibly damaging 0.81
R8001:Pole UTSW 5 110312734 missense probably damaging 1.00
R8266:Pole UTSW 5 110294920 missense probably damaging 1.00
R8510:Pole UTSW 5 110334446 missense probably damaging 0.99
R8793:Pole UTSW 5 110297748 missense probably damaging 1.00
R8863:Pole UTSW 5 110289367 missense possibly damaging 0.94
R8929:Pole UTSW 5 110297788 missense probably damaging 0.98
R8968:Pole UTSW 5 110312083 missense possibly damaging 0.78
R8992:Pole UTSW 5 110323622 missense possibly damaging 0.88
R9018:Pole UTSW 5 110289809 missense probably benign 0.37
R9177:Pole UTSW 5 110332422 missense probably benign 0.04
R9250:Pole UTSW 5 110299821 missense possibly damaging 0.88
R9262:Pole UTSW 5 110325556 missense probably damaging 0.99
R9262:Pole UTSW 5 110325557 missense probably damaging 1.00
R9367:Pole UTSW 5 110297089 missense probably damaging 0.99
R9383:Pole UTSW 5 110291026 missense possibly damaging 0.61
R9626:Pole UTSW 5 110312093 missense possibly damaging 0.68
R9676:Pole UTSW 5 110295565 missense probably benign 0.00
R9720:Pole UTSW 5 110337043 missense probably benign 0.01
R9787:Pole UTSW 5 110318000 critical splice donor site probably null
R9794:Pole UTSW 5 110318335 missense probably benign 0.01
X0064:Pole UTSW 5 110317904 nonsense probably null
Y5377:Pole UTSW 5 110294891 critical splice acceptor site probably null
Y5380:Pole UTSW 5 110294891 critical splice acceptor site probably null
Z1088:Pole UTSW 5 110327865 missense possibly damaging 0.66
Z1177:Pole UTSW 5 110297009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTGCCTCAGAGATGACC -3'
(R):5'- GCAAACTGATCCAGGTTCATC -3'

Sequencing Primer
(F):5'- CTGCCTCAGAGATGACCAGAGG -3'
(R):5'- CAAACTGATCCAGGTTCATCTGTTAC -3'
Posted On 2021-07-15