Incidental Mutation 'R8836:Slc6a6'
ID 674154
Institutional Source Beutler Lab
Gene Symbol Slc6a6
Ensembl Gene ENSMUSG00000030096
Gene Name solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonyms Taut
MMRRC Submission 068664-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8836 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 91661031-91736044 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 91725444 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 447 (V447A)
Ref Sequence ENSEMBL: ENSMUSP00000032185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032185]
AlphaFold O35316
Predicted Effect probably damaging
Transcript: ENSMUST00000032185
AA Change: V447A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032185
Gene: ENSMUSG00000030096
AA Change: V447A

DomainStartEndE-ValueType
Pfam:SNF 41 568 1.2e-241 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205663
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein that is a member of a family of sodium and chloride-ion dependent transporters. The encoded protein transports taurine and beta-alanine. There is a pseudogene for this gene on chromosome 21. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice have impaired vision associated with retinal degeneration. In addition to the visual defects, mutant mice exhibit reduced female fertility and decreased levels of taurine in a variety of tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap4m1 T A 5: 138,173,061 (GRCm39) I134N probably damaging Het
Cacna1b A G 2: 24,542,982 (GRCm39) V1294A possibly damaging Het
Carmil1 A T 13: 24,339,029 (GRCm39) S160T probably damaging Het
Ccdc7b C A 8: 129,857,512 (GRCm39) probably benign Het
Chd9 T G 8: 91,767,812 (GRCm39) N2436K probably damaging Het
Cradd G A 10: 95,158,462 (GRCm39) A95V probably benign Het
Cttnbp2 T G 6: 18,375,952 (GRCm39) E1529A probably damaging Het
Cyp11b1 T C 15: 74,710,387 (GRCm39) I305V possibly damaging Het
Cyp2j6 A T 4: 96,411,983 (GRCm39) N428K probably damaging Het
Cyp3a44 A T 5: 145,731,728 (GRCm39) S139R probably damaging Het
Dysf C T 6: 84,093,105 (GRCm39) R1073C probably damaging Het
Ei24 A G 9: 36,701,498 (GRCm39) F23S Het
Enam T C 5: 88,639,124 (GRCm39) probably null Het
Ezh2 A T 6: 47,531,196 (GRCm39) C163S probably benign Het
Fam76b T A 9: 13,755,381 (GRCm39) F329L probably benign Het
Gatad2b G A 3: 90,263,507 (GRCm39) A535T probably damaging Het
Gm5622 T A 14: 51,796,770 (GRCm39) probably benign Het
Gm9195 C A 14: 72,695,830 (GRCm39) A1401S probably benign Het
Greb1l A T 18: 10,509,257 (GRCm39) H523L probably benign Het
Grhl3 T A 4: 135,288,640 (GRCm39) N15I probably damaging Het
Gsta3 A T 1: 21,330,283 (GRCm39) Y95F probably benign Het
Htr1f C A 16: 64,747,196 (GRCm39) G32V probably benign Het
Il18r1 C A 1: 40,535,016 (GRCm39) Q404K probably benign Het
Izumo3 A T 4: 92,033,216 (GRCm39) probably null Het
Kctd19 T A 8: 106,112,028 (GRCm39) I806F probably damaging Het
Lama4 G T 10: 38,902,587 (GRCm39) C187F probably damaging Het
Lamp3 T G 16: 19,519,788 (GRCm39) I132L probably benign Het
Ly9 A T 1: 171,432,559 (GRCm39) Y151* probably null Het
Lztr1 T C 16: 17,343,402 (GRCm39) L474P probably benign Het
Mcm9 A T 10: 53,502,130 (GRCm39) Y79N Het
Mocs2 T A 13: 114,961,760 (GRCm39) N80K possibly damaging Het
Mrgbp T A 2: 180,224,712 (GRCm39) C38S probably benign Het
Ncs1 G T 2: 31,136,159 (GRCm39) probably benign Het
Or51a10 G A 7: 103,699,055 (GRCm39) P169S probably benign Het
Or8k17 T C 2: 86,066,888 (GRCm39) N90S probably benign Het
Pakap A G 4: 57,709,916 (GRCm39) D287G probably benign Het
Pax5 A T 4: 44,645,621 (GRCm39) V236E probably benign Het
Pcdhgb5 A G 18: 37,865,260 (GRCm39) I352V probably benign Het
Pik3r5 A G 11: 68,385,104 (GRCm39) T670A probably benign Het
Plxna2 T A 1: 194,479,243 (GRCm39) N1301K possibly damaging Het
Pou2af3 A G 9: 51,182,104 (GRCm39) L156P probably damaging Het
Pou5f2 G A 13: 78,173,886 (GRCm39) G276D probably damaging Het
Ppl C G 16: 4,906,854 (GRCm39) R1147P probably damaging Het
Pramel17 T C 4: 101,693,022 (GRCm39) K326R probably benign Het
Prkdc C A 16: 15,545,523 (GRCm39) R1880S probably damaging Het
Rbfox1 T A 16: 7,227,605 (GRCm39) D373E probably benign Het
Rbm24 A G 13: 46,582,780 (GRCm39) D233G probably damaging Het
Rbp3 A T 14: 33,680,588 (GRCm39) E1063D possibly damaging Het
Rc3h2 A G 2: 37,267,941 (GRCm39) V939A possibly damaging Het
Relb C A 7: 19,345,799 (GRCm39) V385L possibly damaging Het
Robo4 T G 9: 37,317,130 (GRCm39) S482A unknown Het
Ryr1 A C 7: 28,774,091 (GRCm39) L2426R probably damaging Het
Sass6 A T 3: 116,407,598 (GRCm39) E238V possibly damaging Het
Ski T C 4: 155,245,047 (GRCm39) I400V probably benign Het
Slc27a2 C A 2: 126,416,656 (GRCm39) A336D Het
Slc30a3 T C 5: 31,250,668 (GRCm39) T12A possibly damaging Het
Smad1 T A 8: 80,098,554 (GRCm39) I87F probably damaging Het
Spns1 G A 7: 125,971,593 (GRCm39) S319F possibly damaging Het
Sytl3 C A 17: 6,973,410 (GRCm39) T237N possibly damaging Het
Tdrd7 A G 4: 45,987,570 (GRCm39) T68A probably damaging Het
Tex56 T A 13: 35,116,526 (GRCm39) W92R probably damaging Het
Tmem135 G C 7: 88,797,186 (GRCm39) L357V probably benign Het
Tmem238 A G 7: 4,792,520 (GRCm39) C8R possibly damaging Het
Ubxn2b A T 4: 6,216,061 (GRCm39) Q328L probably damaging Het
Vmn1r226 A G 17: 20,908,133 (GRCm39) T122A probably benign Het
Vps13d A G 4: 144,882,648 (GRCm39) F982L Het
Xpo4 T C 14: 57,902,367 (GRCm39) E16G probably benign Het
Zbtb17 T A 4: 141,189,233 (GRCm39) M51K possibly damaging Het
Zdhhc1 A G 8: 106,200,173 (GRCm39) F315S probably benign Het
Zfp568 C T 7: 29,722,459 (GRCm39) T468M probably damaging Het
Other mutations in Slc6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Slc6a6 APN 6 91,718,151 (GRCm39) intron probably benign
IGL01829:Slc6a6 APN 6 91,712,170 (GRCm39) missense probably damaging 1.00
IGL01896:Slc6a6 APN 6 91,703,050 (GRCm39) missense probably damaging 0.97
IGL02087:Slc6a6 APN 6 91,712,160 (GRCm39) missense probably benign
IGL02301:Slc6a6 APN 6 91,703,037 (GRCm39) missense probably benign 0.31
IGL02439:Slc6a6 APN 6 91,726,808 (GRCm39) missense probably damaging 0.99
IGL02555:Slc6a6 APN 6 91,725,311 (GRCm39) unclassified probably benign
animas UTSW 6 91,716,995 (GRCm39) splice site probably null
customary UTSW 6 91,703,224 (GRCm39) nonsense probably null
durango UTSW 6 91,700,452 (GRCm39) missense probably damaging 1.00
habit UTSW 6 91,717,952 (GRCm39) missense probably damaging 1.00
R5861_Slc6a6_905 UTSW 6 91,718,014 (GRCm39) missense probably damaging 1.00
R6665_Slc6a6_931 UTSW 6 91,703,020 (GRCm39) missense probably benign 0.38
R0530:Slc6a6 UTSW 6 91,701,939 (GRCm39) missense probably null 0.04
R1327:Slc6a6 UTSW 6 91,703,016 (GRCm39) missense probably benign 0.00
R1503:Slc6a6 UTSW 6 91,717,973 (GRCm39) missense probably damaging 1.00
R1612:Slc6a6 UTSW 6 91,718,008 (GRCm39) missense probably damaging 1.00
R2033:Slc6a6 UTSW 6 91,701,891 (GRCm39) missense probably benign 0.12
R2146:Slc6a6 UTSW 6 91,712,161 (GRCm39) missense probably benign 0.05
R2309:Slc6a6 UTSW 6 91,703,177 (GRCm39) missense possibly damaging 0.63
R2434:Slc6a6 UTSW 6 91,712,193 (GRCm39) missense probably benign 0.33
R2656:Slc6a6 UTSW 6 91,718,029 (GRCm39) missense probably damaging 1.00
R3402:Slc6a6 UTSW 6 91,703,110 (GRCm39) missense probably benign
R3403:Slc6a6 UTSW 6 91,703,110 (GRCm39) missense probably benign
R3978:Slc6a6 UTSW 6 91,732,033 (GRCm39) missense probably benign 0.41
R4236:Slc6a6 UTSW 6 91,718,257 (GRCm39) missense probably damaging 0.98
R4332:Slc6a6 UTSW 6 91,700,452 (GRCm39) missense probably damaging 1.00
R4980:Slc6a6 UTSW 6 91,703,041 (GRCm39) missense probably damaging 1.00
R5326:Slc6a6 UTSW 6 91,712,170 (GRCm39) missense probably damaging 1.00
R5358:Slc6a6 UTSW 6 91,712,155 (GRCm39) missense probably benign 0.28
R5542:Slc6a6 UTSW 6 91,712,170 (GRCm39) missense probably damaging 1.00
R5774:Slc6a6 UTSW 6 91,721,981 (GRCm39) missense probably damaging 1.00
R5839:Slc6a6 UTSW 6 91,700,298 (GRCm39) missense probably damaging 1.00
R5861:Slc6a6 UTSW 6 91,718,014 (GRCm39) missense probably damaging 1.00
R5939:Slc6a6 UTSW 6 91,731,929 (GRCm39) missense probably benign 0.01
R6160:Slc6a6 UTSW 6 91,716,995 (GRCm39) splice site probably null
R6262:Slc6a6 UTSW 6 91,732,013 (GRCm39) missense possibly damaging 0.66
R6265:Slc6a6 UTSW 6 91,731,896 (GRCm39) missense probably damaging 0.99
R6665:Slc6a6 UTSW 6 91,703,020 (GRCm39) missense probably benign 0.38
R6998:Slc6a6 UTSW 6 91,729,419 (GRCm39) missense probably benign 0.21
R7057:Slc6a6 UTSW 6 91,718,248 (GRCm39) missense probably damaging 1.00
R7568:Slc6a6 UTSW 6 91,701,832 (GRCm39) missense probably damaging 1.00
R7768:Slc6a6 UTSW 6 91,716,946 (GRCm39) missense probably damaging 0.99
R8042:Slc6a6 UTSW 6 91,718,226 (GRCm39) missense probably benign 0.11
R8125:Slc6a6 UTSW 6 91,703,087 (GRCm39) missense probably damaging 0.97
R8194:Slc6a6 UTSW 6 91,717,952 (GRCm39) missense probably damaging 1.00
R8239:Slc6a6 UTSW 6 91,701,951 (GRCm39) missense probably benign 0.00
R8343:Slc6a6 UTSW 6 91,703,224 (GRCm39) nonsense probably null
R8363:Slc6a6 UTSW 6 91,727,277 (GRCm39) missense probably benign 0.03
R9102:Slc6a6 UTSW 6 91,731,940 (GRCm39) missense probably benign 0.10
R9257:Slc6a6 UTSW 6 91,716,952 (GRCm39) missense possibly damaging 0.74
R9511:Slc6a6 UTSW 6 91,721,921 (GRCm39) missense probably damaging 1.00
R9526:Slc6a6 UTSW 6 91,726,808 (GRCm39) missense probably benign 0.02
R9701:Slc6a6 UTSW 6 91,700,478 (GRCm39) missense probably damaging 1.00
X0002:Slc6a6 UTSW 6 91,700,457 (GRCm39) missense probably damaging 1.00
X0063:Slc6a6 UTSW 6 91,718,205 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAGGTGGGTCTCATGAG -3'
(R):5'- GACCACAGCATCTCAGTAAGGG -3'

Sequencing Primer
(F):5'- TCTCATGAGAGGTAGCCCAG -3'
(R):5'- CCACAGCATCTCAGTAAGGGAATATG -3'
Posted On 2021-07-15