Incidental Mutation 'R8836:Kctd19'
ID674164
Institutional Source Beutler Lab
Gene Symbol Kctd19
Ensembl Gene ENSMUSG00000051648
Gene Namepotassium channel tetramerisation domain containing 19
Synonyms4922504H04Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R8836 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location105382807-105413502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105385396 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 806 (I806F)
Ref Sequence ENSEMBL: ENSMUSP00000050687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014927] [ENSMUST00000063071] [ENSMUST00000159286] [ENSMUST00000160191] [ENSMUST00000167294] [ENSMUST00000168196] [ENSMUST00000214056]
Predicted Effect probably benign
Transcript: ENSMUST00000014927
SMART Domains Protein: ENSMUSP00000014927
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
low complexity region 364 377 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
RhoGEF 729 900 3.15e-29 SMART
PH 914 1022 1.44e-5 SMART
low complexity region 1148 1169 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000063071
AA Change: I806F

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050687
Gene: ENSMUSG00000051648
AA Change: I806F

DomainStartEndE-ValueType
Pfam:BTB_2 15 92 1.3e-9 PFAM
internal_repeat_1 173 251 8.34e-9 PROSPERO
internal_repeat_1 429 509 8.34e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000159286
SMART Domains Protein: ENSMUSP00000125556
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
SCOP:d1aua_2 136 275 5e-9 SMART
Blast:SEC14 137 271 9e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160191
SMART Domains Protein: ENSMUSP00000125249
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
low complexity region 295 308 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 394 406 N/A INTRINSIC
low complexity region 466 478 N/A INTRINSIC
low complexity region 490 508 N/A INTRINSIC
low complexity region 584 595 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
RhoGEF 660 831 3.15e-29 SMART
PH 845 953 1.44e-5 SMART
low complexity region 1079 1100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167294
AA Change: I783F

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130831
Gene: ENSMUSG00000051648
AA Change: I783F

DomainStartEndE-ValueType
Pfam:BTB_2 15 93 3.9e-10 PFAM
internal_repeat_1 173 251 6.24e-9 PROSPERO
internal_repeat_1 406 486 6.24e-9 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000168196
AA Change: I8F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000214056
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik T A 13: 34,932,543 W92R probably damaging Het
Ap4m1 T A 5: 138,174,799 I134N probably damaging Het
B020004J07Rik T C 4: 101,835,825 K326R probably benign Het
Cacna1b A G 2: 24,652,970 V1294A possibly damaging Het
Carmil1 A T 13: 24,155,046 S160T probably damaging Het
Chd9 T G 8: 91,041,184 N2436K probably damaging Het
Colca2 A G 9: 51,270,804 L156P probably damaging Het
Cradd G A 10: 95,322,600 A95V probably benign Het
Cttnbp2 T G 6: 18,375,953 E1529A probably damaging Het
Cyp11b1 T C 15: 74,838,538 I305V possibly damaging Het
Cyp2j6 A T 4: 96,523,746 N428K probably damaging Het
Cyp3a44 A T 5: 145,794,918 S139R probably damaging Het
Dysf C T 6: 84,116,123 R1073C probably damaging Het
Ei24 A G 9: 36,790,202 F23S Het
Enam T C 5: 88,491,265 probably null Het
Ezh2 A T 6: 47,554,262 C163S probably benign Het
Fam76b T A 9: 13,844,085 F329L probably benign Het
Gatad2b G A 3: 90,356,200 A535T probably damaging Het
Gm9195 C A 14: 72,458,390 A1401S probably benign Het
Greb1l A T 18: 10,509,257 H523L probably benign Het
Grhl3 T A 4: 135,561,329 N15I probably damaging Het
Gsta3 A T 1: 21,260,059 Y95F probably benign Het
Htr1f C A 16: 64,926,833 G32V probably benign Het
Il18r1 C A 1: 40,495,856 Q404K probably benign Het
Izumo3 A T 4: 92,144,979 probably null Het
Lama4 G T 10: 39,026,591 C187F probably damaging Het
Lamp3 T G 16: 19,701,038 I132L probably benign Het
Ly9 A T 1: 171,604,991 Y151* probably null Het
Lztr1 T C 16: 17,525,538 L474P probably benign Het
Mcm9 A T 10: 53,626,034 Y79N Het
Mocs2 T A 13: 114,825,224 N80K possibly damaging Het
Mrgbp T A 2: 180,582,919 C38S probably benign Het
Ncs1 G T 2: 31,246,147 probably benign Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Olfr1048 T C 2: 86,236,544 N90S probably benign Het
Olfr642 G A 7: 104,049,848 P169S probably benign Het
Palm2 A G 4: 57,709,916 D287G probably benign Het
Pax5 A T 4: 44,645,621 V236E probably benign Het
Pcdhgb5 A G 18: 37,732,207 I352V probably benign Het
Pik3r5 A G 11: 68,494,278 T670A probably benign Het
Plxna2 T A 1: 194,796,935 N1301K possibly damaging Het
Pou5f2 G A 13: 78,025,767 G276D probably damaging Het
Ppl C G 16: 5,088,990 R1147P probably damaging Het
Prkdc C A 16: 15,727,659 R1880S probably damaging Het
Rbfox1 T A 16: 7,409,741 D373E probably benign Het
Rbm24 A G 13: 46,429,304 D233G probably damaging Het
Rbp3 A T 14: 33,958,631 E1063D possibly damaging Het
Rc3h2 A G 2: 37,377,929 V939A possibly damaging Het
Relb C A 7: 19,611,874 V385L possibly damaging Het
Robo4 T G 9: 37,405,834 S482A unknown Het
Ryr1 A C 7: 29,074,666 L2426R probably damaging Het
Sass6 A T 3: 116,613,949 E238V possibly damaging Het
Ski T C 4: 155,160,590 I400V probably benign Het
Slc27a2 C A 2: 126,574,736 A336D Het
Slc30a3 T C 5: 31,093,324 T12A possibly damaging Het
Slc6a6 T C 6: 91,748,463 V447A probably damaging Het
Smad1 T A 8: 79,371,925 I87F probably damaging Het
Spns1 G A 7: 126,372,421 S319F possibly damaging Het
Sytl3 C A 17: 6,706,011 T237N possibly damaging Het
Tdrd7 A G 4: 45,987,570 T68A probably damaging Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tmem238 A G 7: 4,789,521 C8R possibly damaging Het
Ubxn2b A T 4: 6,216,061 Q328L probably damaging Het
Vmn1r226 A G 17: 20,687,871 T122A probably benign Het
Vps13d A G 4: 145,156,078 F982L Het
Xpo4 T C 14: 57,664,910 E16G probably benign Het
Zbtb17 T A 4: 141,461,922 M51K possibly damaging Het
Zdhhc1 A G 8: 105,473,541 F315S probably benign Het
Zfp568 C T 7: 30,023,034 T468M probably damaging Het
Other mutations in Kctd19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Kctd19 APN 8 105388463 critical splice donor site probably null
IGL01546:Kctd19 APN 8 105386962 missense probably benign
IGL01786:Kctd19 APN 8 105390304 missense probably benign 0.03
IGL01964:Kctd19 APN 8 105388525 missense probably damaging 0.99
IGL02275:Kctd19 APN 8 105396374 missense probably damaging 0.99
IGL02479:Kctd19 APN 8 105384768 missense probably damaging 1.00
IGL03124:Kctd19 APN 8 105387070 missense possibly damaging 0.48
R0003:Kctd19 UTSW 8 105395361 missense probably damaging 0.99
R1183:Kctd19 UTSW 8 105382966 missense probably benign
R1388:Kctd19 UTSW 8 105392051 missense probably null 0.93
R1491:Kctd19 UTSW 8 105387062 missense possibly damaging 0.60
R1517:Kctd19 UTSW 8 105395376 missense probably damaging 1.00
R1540:Kctd19 UTSW 8 105387879 missense probably damaging 0.96
R1582:Kctd19 UTSW 8 105395460 missense probably damaging 1.00
R1964:Kctd19 UTSW 8 105388470 missense probably damaging 0.98
R1996:Kctd19 UTSW 8 105395300 missense probably null 1.00
R2129:Kctd19 UTSW 8 105385172 missense probably damaging 0.98
R2281:Kctd19 UTSW 8 105387266 missense probably benign 0.00
R3767:Kctd19 UTSW 8 105396480 missense probably benign 0.04
R3768:Kctd19 UTSW 8 105396480 missense probably benign 0.04
R4285:Kctd19 UTSW 8 105382949 unclassified probably benign
R4621:Kctd19 UTSW 8 105396471 missense probably damaging 1.00
R4701:Kctd19 UTSW 8 105390429 missense possibly damaging 0.76
R4969:Kctd19 UTSW 8 105396327 splice site probably null
R5070:Kctd19 UTSW 8 105391999 missense probably damaging 1.00
R5401:Kctd19 UTSW 8 105382985 missense probably benign 0.00
R5582:Kctd19 UTSW 8 105408443 missense probably damaging 1.00
R5783:Kctd19 UTSW 8 105386980 missense probably benign
R6056:Kctd19 UTSW 8 105396450 missense probably damaging 0.99
R6057:Kctd19 UTSW 8 105396450 missense probably damaging 0.99
R6269:Kctd19 UTSW 8 105395360 missense possibly damaging 0.96
R6273:Kctd19 UTSW 8 105385485 missense probably benign
R6631:Kctd19 UTSW 8 105385328 critical splice donor site probably null
R7298:Kctd19 UTSW 8 105382984 missense probably benign 0.01
R7474:Kctd19 UTSW 8 105392032 missense probably benign 0.25
R7540:Kctd19 UTSW 8 105386935 missense probably benign 0.00
R7923:Kctd19 UTSW 8 105385058 missense probably damaging 1.00
R8059:Kctd19 UTSW 8 105396351 missense probably benign 0.02
R8117:Kctd19 UTSW 8 105395437 missense unknown
Z1088:Kctd19 UTSW 8 105385335 missense probably benign 0.02
Z1176:Kctd19 UTSW 8 105385136 missense probably damaging 1.00
Z1177:Kctd19 UTSW 8 105388517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAGCAGTCCACGGCTAAGG -3'
(R):5'- TACTGATCTGTCACCAGGAGC -3'

Sequencing Primer
(F):5'- GCTAAGGCCTCAGAGAGAAACAC -3'
(R):5'- TCTGCTTGCACTGAGCCTAGG -3'
Posted On2021-07-15