Incidental Mutation 'R8836:Kctd19'
ID 674164
Institutional Source Beutler Lab
Gene Symbol Kctd19
Ensembl Gene ENSMUSG00000051648
Gene Name potassium channel tetramerisation domain containing 19
Synonyms 4922504H04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8836 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 105382807-105413502 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 105385396 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 806 (I806F)
Ref Sequence ENSEMBL: ENSMUSP00000050687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014927] [ENSMUST00000063071] [ENSMUST00000159286] [ENSMUST00000160191] [ENSMUST00000167294] [ENSMUST00000168196] [ENSMUST00000214056]
AlphaFold Q562E2
Predicted Effect probably benign
Transcript: ENSMUST00000014927
SMART Domains Protein: ENSMUSP00000014927
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
low complexity region 364 377 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
RhoGEF 729 900 3.15e-29 SMART
PH 914 1022 1.44e-5 SMART
low complexity region 1148 1169 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000063071
AA Change: I806F

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050687
Gene: ENSMUSG00000051648
AA Change: I806F

DomainStartEndE-ValueType
Pfam:BTB_2 15 92 1.3e-9 PFAM
internal_repeat_1 173 251 8.34e-9 PROSPERO
internal_repeat_1 429 509 8.34e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000159286
SMART Domains Protein: ENSMUSP00000125556
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
SCOP:d1aua_2 136 275 5e-9 SMART
Blast:SEC14 137 271 9e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160191
SMART Domains Protein: ENSMUSP00000125249
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
low complexity region 295 308 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 394 406 N/A INTRINSIC
low complexity region 466 478 N/A INTRINSIC
low complexity region 490 508 N/A INTRINSIC
low complexity region 584 595 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
RhoGEF 660 831 3.15e-29 SMART
PH 845 953 1.44e-5 SMART
low complexity region 1079 1100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167294
AA Change: I783F

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130831
Gene: ENSMUSG00000051648
AA Change: I783F

DomainStartEndE-ValueType
Pfam:BTB_2 15 93 3.9e-10 PFAM
internal_repeat_1 173 251 6.24e-9 PROSPERO
internal_repeat_1 406 486 6.24e-9 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000168196
AA Change: I8F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000214056
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik T A 13: 34,932,543 W92R probably damaging Het
Ap4m1 T A 5: 138,174,799 I134N probably damaging Het
B020004J07Rik T C 4: 101,835,825 K326R probably benign Het
Cacna1b A G 2: 24,652,970 V1294A possibly damaging Het
Carmil1 A T 13: 24,155,046 S160T probably damaging Het
Ccdc7b C A 8: 129,131,031 probably benign Het
Chd9 T G 8: 91,041,184 N2436K probably damaging Het
Colca2 A G 9: 51,270,804 L156P probably damaging Het
Cradd G A 10: 95,322,600 A95V probably benign Het
Cttnbp2 T G 6: 18,375,953 E1529A probably damaging Het
Cyp11b1 T C 15: 74,838,538 I305V possibly damaging Het
Cyp2j6 A T 4: 96,523,746 N428K probably damaging Het
Cyp3a44 A T 5: 145,794,918 S139R probably damaging Het
Dysf C T 6: 84,116,123 R1073C probably damaging Het
Ei24 A G 9: 36,790,202 F23S Het
Enam T C 5: 88,491,265 probably null Het
Ezh2 A T 6: 47,554,262 C163S probably benign Het
Fam76b T A 9: 13,844,085 F329L probably benign Het
Gatad2b G A 3: 90,356,200 A535T probably damaging Het
Gm5622 T A 14: 51,559,313 probably benign Het
Gm9195 C A 14: 72,458,390 A1401S probably benign Het
Greb1l A T 18: 10,509,257 H523L probably benign Het
Grhl3 T A 4: 135,561,329 N15I probably damaging Het
Gsta3 A T 1: 21,260,059 Y95F probably benign Het
Htr1f C A 16: 64,926,833 G32V probably benign Het
Il18r1 C A 1: 40,495,856 Q404K probably benign Het
Izumo3 A T 4: 92,144,979 probably null Het
Lama4 G T 10: 39,026,591 C187F probably damaging Het
Lamp3 T G 16: 19,701,038 I132L probably benign Het
Ly9 A T 1: 171,604,991 Y151* probably null Het
Lztr1 T C 16: 17,525,538 L474P probably benign Het
Mcm9 A T 10: 53,626,034 Y79N Het
Mocs2 T A 13: 114,825,224 N80K possibly damaging Het
Mrgbp T A 2: 180,582,919 C38S probably benign Het
Ncs1 G T 2: 31,246,147 probably benign Het
Olfr1048 T C 2: 86,236,544 N90S probably benign Het
Olfr642 G A 7: 104,049,848 P169S probably benign Het
Palm2 A G 4: 57,709,916 D287G probably benign Het
Pax5 A T 4: 44,645,621 V236E probably benign Het
Pcdhgb5 A G 18: 37,732,207 I352V probably benign Het
Pik3r5 A G 11: 68,494,278 T670A probably benign Het
Plxna2 T A 1: 194,796,935 N1301K possibly damaging Het
Pou5f2 G A 13: 78,025,767 G276D probably damaging Het
Ppl C G 16: 5,088,990 R1147P probably damaging Het
Prkdc C A 16: 15,727,659 R1880S probably damaging Het
Rbfox1 T A 16: 7,409,741 D373E probably benign Het
Rbm24 A G 13: 46,429,304 D233G probably damaging Het
Rbp3 A T 14: 33,958,631 E1063D possibly damaging Het
Rc3h2 A G 2: 37,377,929 V939A possibly damaging Het
Relb C A 7: 19,611,874 V385L possibly damaging Het
Robo4 T G 9: 37,405,834 S482A unknown Het
Ryr1 A C 7: 29,074,666 L2426R probably damaging Het
Sass6 A T 3: 116,613,949 E238V possibly damaging Het
Ski T C 4: 155,160,590 I400V probably benign Het
Slc27a2 C A 2: 126,574,736 A336D Het
Slc30a3 T C 5: 31,093,324 T12A possibly damaging Het
Slc6a6 T C 6: 91,748,463 V447A probably damaging Het
Smad1 T A 8: 79,371,925 I87F probably damaging Het
Spns1 G A 7: 126,372,421 S319F possibly damaging Het
Sytl3 C A 17: 6,706,011 T237N possibly damaging Het
Tdrd7 A G 4: 45,987,570 T68A probably damaging Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tmem238 A G 7: 4,789,521 C8R possibly damaging Het
Ubxn2b A T 4: 6,216,061 Q328L probably damaging Het
Vmn1r226 A G 17: 20,687,871 T122A probably benign Het
Vps13d A G 4: 145,156,078 F982L Het
Xpo4 T C 14: 57,664,910 E16G probably benign Het
Zbtb17 T A 4: 141,461,922 M51K possibly damaging Het
Zdhhc1 A G 8: 105,473,541 F315S probably benign Het
Zfp568 C T 7: 30,023,034 T468M probably damaging Het
Other mutations in Kctd19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Kctd19 APN 8 105388463 critical splice donor site probably null
IGL01546:Kctd19 APN 8 105386962 missense probably benign
IGL01786:Kctd19 APN 8 105390304 missense probably benign 0.03
IGL01964:Kctd19 APN 8 105388525 missense probably damaging 0.99
IGL02275:Kctd19 APN 8 105396374 missense probably damaging 0.99
IGL02479:Kctd19 APN 8 105384768 missense probably damaging 1.00
IGL03124:Kctd19 APN 8 105387070 missense possibly damaging 0.48
R0003:Kctd19 UTSW 8 105395361 missense probably damaging 0.99
R1183:Kctd19 UTSW 8 105382966 missense probably benign
R1388:Kctd19 UTSW 8 105392051 missense probably null 0.93
R1491:Kctd19 UTSW 8 105387062 missense possibly damaging 0.60
R1517:Kctd19 UTSW 8 105395376 missense probably damaging 1.00
R1540:Kctd19 UTSW 8 105387879 missense probably damaging 0.96
R1582:Kctd19 UTSW 8 105395460 missense probably damaging 1.00
R1964:Kctd19 UTSW 8 105388470 missense probably damaging 0.98
R1996:Kctd19 UTSW 8 105395300 missense probably null 1.00
R2129:Kctd19 UTSW 8 105385172 missense probably damaging 0.98
R2281:Kctd19 UTSW 8 105387266 missense probably benign 0.00
R3767:Kctd19 UTSW 8 105396480 missense probably benign 0.04
R3768:Kctd19 UTSW 8 105396480 missense probably benign 0.04
R4285:Kctd19 UTSW 8 105382949 unclassified probably benign
R4621:Kctd19 UTSW 8 105396471 missense probably damaging 1.00
R4701:Kctd19 UTSW 8 105390429 missense possibly damaging 0.76
R4969:Kctd19 UTSW 8 105396327 splice site probably null
R5070:Kctd19 UTSW 8 105391999 missense probably damaging 1.00
R5401:Kctd19 UTSW 8 105382985 missense probably benign 0.00
R5582:Kctd19 UTSW 8 105408443 missense probably damaging 1.00
R5783:Kctd19 UTSW 8 105386980 missense probably benign
R6056:Kctd19 UTSW 8 105396450 missense probably damaging 0.99
R6057:Kctd19 UTSW 8 105396450 missense probably damaging 0.99
R6269:Kctd19 UTSW 8 105395360 missense possibly damaging 0.96
R6273:Kctd19 UTSW 8 105385485 missense probably benign
R6631:Kctd19 UTSW 8 105385328 critical splice donor site probably null
R7298:Kctd19 UTSW 8 105382984 missense probably benign 0.01
R7474:Kctd19 UTSW 8 105392032 missense probably benign 0.25
R7540:Kctd19 UTSW 8 105386935 missense probably benign 0.00
R7923:Kctd19 UTSW 8 105385058 missense probably damaging 1.00
R8059:Kctd19 UTSW 8 105396351 missense probably benign 0.02
R8117:Kctd19 UTSW 8 105395437 missense unknown
R9155:Kctd19 UTSW 8 105393939 missense probably benign 0.01
R9429:Kctd19 UTSW 8 105383020 missense probably damaging 0.98
R9481:Kctd19 UTSW 8 105393617 missense probably benign 0.00
R9627:Kctd19 UTSW 8 105387365 missense probably benign 0.01
Z1088:Kctd19 UTSW 8 105385335 missense probably benign 0.02
Z1176:Kctd19 UTSW 8 105385136 missense probably damaging 1.00
Z1177:Kctd19 UTSW 8 105388517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAGCAGTCCACGGCTAAGG -3'
(R):5'- TACTGATCTGTCACCAGGAGC -3'

Sequencing Primer
(F):5'- GCTAAGGCCTCAGAGAGAAACAC -3'
(R):5'- TCTGCTTGCACTGAGCCTAGG -3'
Posted On 2021-07-15