Incidental Mutation 'R8836:Htr1f'
ID674189
Institutional Source Beutler Lab
Gene Symbol Htr1f
Ensembl Gene ENSMUSG00000050783
Gene Name5-hydroxytryptamine (serotonin) receptor 1F
SynonymsHtr1eb
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8836 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location64924729-65105854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 64926833 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 32 (G32V)
Ref Sequence ENSEMBL: ENSMUSP00000063136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063076]
Predicted Effect probably benign
Transcript: ENSMUST00000063076
AA Change: G32V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063136
Gene: ENSMUSG00000050783
AA Change: G32V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 32 230 4.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 34 362 2.4e-10 PFAM
Pfam:7tm_1 40 347 4.1e-74 PFAM
Pfam:7TM_GPCR_Srv 54 249 5.2e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display decreased temperature sensitivity and physiological abnormalities in nerve fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik T A 13: 34,932,543 W92R probably damaging Het
Ap4m1 T A 5: 138,174,799 I134N probably damaging Het
B020004J07Rik T C 4: 101,835,825 K326R probably benign Het
Cacna1b A G 2: 24,652,970 V1294A possibly damaging Het
Carmil1 A T 13: 24,155,046 S160T probably damaging Het
Chd9 T G 8: 91,041,184 N2436K probably damaging Het
Colca2 A G 9: 51,270,804 L156P probably damaging Het
Cradd G A 10: 95,322,600 A95V probably benign Het
Cttnbp2 T G 6: 18,375,953 E1529A probably damaging Het
Cyp11b1 T C 15: 74,838,538 I305V possibly damaging Het
Cyp2j6 A T 4: 96,523,746 N428K probably damaging Het
Cyp3a44 A T 5: 145,794,918 S139R probably damaging Het
Dysf C T 6: 84,116,123 R1073C probably damaging Het
Ei24 A G 9: 36,790,202 F23S Het
Enam T C 5: 88,491,265 probably null Het
Ezh2 A T 6: 47,554,262 C163S probably benign Het
Fam76b T A 9: 13,844,085 F329L probably benign Het
Gatad2b G A 3: 90,356,200 A535T probably damaging Het
Gm9195 C A 14: 72,458,390 A1401S probably benign Het
Greb1l A T 18: 10,509,257 H523L probably benign Het
Grhl3 T A 4: 135,561,329 N15I probably damaging Het
Gsta3 A T 1: 21,260,059 Y95F probably benign Het
Il18r1 C A 1: 40,495,856 Q404K probably benign Het
Izumo3 A T 4: 92,144,979 probably null Het
Kctd19 T A 8: 105,385,396 I806F probably damaging Het
Lama4 G T 10: 39,026,591 C187F probably damaging Het
Lamp3 T G 16: 19,701,038 I132L probably benign Het
Ly9 A T 1: 171,604,991 Y151* probably null Het
Lztr1 T C 16: 17,525,538 L474P probably benign Het
Mcm9 A T 10: 53,626,034 Y79N Het
Mocs2 T A 13: 114,825,224 N80K possibly damaging Het
Mrgbp T A 2: 180,582,919 C38S probably benign Het
Ncs1 G T 2: 31,246,147 probably benign Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Olfr1048 T C 2: 86,236,544 N90S probably benign Het
Olfr642 G A 7: 104,049,848 P169S probably benign Het
Palm2 A G 4: 57,709,916 D287G probably benign Het
Pax5 A T 4: 44,645,621 V236E probably benign Het
Pcdhgb5 A G 18: 37,732,207 I352V probably benign Het
Pik3r5 A G 11: 68,494,278 T670A probably benign Het
Plxna2 T A 1: 194,796,935 N1301K possibly damaging Het
Pou5f2 G A 13: 78,025,767 G276D probably damaging Het
Ppl C G 16: 5,088,990 R1147P probably damaging Het
Prkdc C A 16: 15,727,659 R1880S probably damaging Het
Rbfox1 T A 16: 7,409,741 D373E probably benign Het
Rbm24 A G 13: 46,429,304 D233G probably damaging Het
Rbp3 A T 14: 33,958,631 E1063D possibly damaging Het
Rc3h2 A G 2: 37,377,929 V939A possibly damaging Het
Relb C A 7: 19,611,874 V385L possibly damaging Het
Robo4 T G 9: 37,405,834 S482A unknown Het
Ryr1 A C 7: 29,074,666 L2426R probably damaging Het
Sass6 A T 3: 116,613,949 E238V possibly damaging Het
Ski T C 4: 155,160,590 I400V probably benign Het
Slc27a2 C A 2: 126,574,736 A336D Het
Slc30a3 T C 5: 31,093,324 T12A possibly damaging Het
Slc6a6 T C 6: 91,748,463 V447A probably damaging Het
Smad1 T A 8: 79,371,925 I87F probably damaging Het
Spns1 G A 7: 126,372,421 S319F possibly damaging Het
Sytl3 C A 17: 6,706,011 T237N possibly damaging Het
Tdrd7 A G 4: 45,987,570 T68A probably damaging Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tmem238 A G 7: 4,789,521 C8R possibly damaging Het
Ubxn2b A T 4: 6,216,061 Q328L probably damaging Het
Vmn1r226 A G 17: 20,687,871 T122A probably benign Het
Vps13d A G 4: 145,156,078 F982L Het
Xpo4 T C 14: 57,664,910 E16G probably benign Het
Zbtb17 T A 4: 141,461,922 M51K possibly damaging Het
Zdhhc1 A G 8: 105,473,541 F315S probably benign Het
Zfp568 C T 7: 30,023,034 T468M probably damaging Het
Other mutations in Htr1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Htr1f APN 16 64926106 missense probably benign 0.00
IGL01134:Htr1f APN 16 64926138 missense probably benign 0.00
IGL01455:Htr1f APN 16 64926022 missense probably damaging 1.00
IGL01580:Htr1f APN 16 64925835 nonsense probably null
IGL01865:Htr1f APN 16 64925919 missense probably damaging 1.00
IGL02027:Htr1f APN 16 64926321 nonsense probably null
IGL02234:Htr1f APN 16 64926067 missense probably damaging 1.00
IGL02567:Htr1f APN 16 64926248 missense probably benign 0.45
R0035:Htr1f UTSW 16 64926497 missense probably damaging 1.00
R0131:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0131:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0132:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0193:Htr1f UTSW 16 64926749 missense probably damaging 1.00
R0523:Htr1f UTSW 16 64925899 missense probably damaging 1.00
R0722:Htr1f UTSW 16 64925891 missense probably damaging 0.99
R2055:Htr1f UTSW 16 64926035 missense probably damaging 1.00
R3418:Htr1f UTSW 16 64925897 missense probably damaging 1.00
R4090:Htr1f UTSW 16 64925961 missense probably benign 0.06
R4320:Htr1f UTSW 16 64926687 missense possibly damaging 0.87
R5037:Htr1f UTSW 16 64925928 missense probably damaging 1.00
R6004:Htr1f UTSW 16 64925876 missense probably damaging 1.00
R7383:Htr1f UTSW 16 64926843 missense probably benign 0.00
R7462:Htr1f UTSW 16 64926020 missense probably damaging 0.99
R7864:Htr1f UTSW 16 64926794 missense probably damaging 1.00
R8677:Htr1f UTSW 16 64926051 missense possibly damaging 0.69
R8816:Htr1f UTSW 16 64926174 missense probably benign 0.05
Z1176:Htr1f UTSW 16 64926077 nonsense probably null
Z1176:Htr1f UTSW 16 64926874 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCGACACTCAGCCAAATGTC -3'
(R):5'- AGCACGATACTTGAAACTTTCTCTG -3'

Sequencing Primer
(F):5'- GCCAAATGTCACAGAGTACTTGTC -3'
(R):5'- GAAACTTTCTCTGAACTATGTTTCCC -3'
Posted On2021-07-15