Incidental Mutation 'R8836:Greb1l'
ID674192
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Namegrowth regulation by estrogen in breast cancer-like
SynonymsAK220484, mKIAA4095
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8836 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location10325177-10562934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10509257 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 523 (H523L)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: H523L

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: H523L

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172532
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik T A 13: 34,932,543 W92R probably damaging Het
Ap4m1 T A 5: 138,174,799 I134N probably damaging Het
B020004J07Rik T C 4: 101,835,825 K326R probably benign Het
Cacna1b A G 2: 24,652,970 V1294A possibly damaging Het
Carmil1 A T 13: 24,155,046 S160T probably damaging Het
Chd9 T G 8: 91,041,184 N2436K probably damaging Het
Colca2 A G 9: 51,270,804 L156P probably damaging Het
Cradd G A 10: 95,322,600 A95V probably benign Het
Cttnbp2 T G 6: 18,375,953 E1529A probably damaging Het
Cyp11b1 T C 15: 74,838,538 I305V possibly damaging Het
Cyp2j6 A T 4: 96,523,746 N428K probably damaging Het
Cyp3a44 A T 5: 145,794,918 S139R probably damaging Het
Dysf C T 6: 84,116,123 R1073C probably damaging Het
Ei24 A G 9: 36,790,202 F23S Het
Enam T C 5: 88,491,265 probably null Het
Ezh2 A T 6: 47,554,262 C163S probably benign Het
Fam76b T A 9: 13,844,085 F329L probably benign Het
Gatad2b G A 3: 90,356,200 A535T probably damaging Het
Gm9195 C A 14: 72,458,390 A1401S probably benign Het
Grhl3 T A 4: 135,561,329 N15I probably damaging Het
Gsta3 A T 1: 21,260,059 Y95F probably benign Het
Htr1f C A 16: 64,926,833 G32V probably benign Het
Il18r1 C A 1: 40,495,856 Q404K probably benign Het
Izumo3 A T 4: 92,144,979 probably null Het
Kctd19 T A 8: 105,385,396 I806F probably damaging Het
Lama4 G T 10: 39,026,591 C187F probably damaging Het
Lamp3 T G 16: 19,701,038 I132L probably benign Het
Ly9 A T 1: 171,604,991 Y151* probably null Het
Lztr1 T C 16: 17,525,538 L474P probably benign Het
Mcm9 A T 10: 53,626,034 Y79N Het
Mocs2 T A 13: 114,825,224 N80K possibly damaging Het
Mrgbp T A 2: 180,582,919 C38S probably benign Het
Ncs1 G T 2: 31,246,147 probably benign Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Olfr1048 T C 2: 86,236,544 N90S probably benign Het
Olfr642 G A 7: 104,049,848 P169S probably benign Het
Palm2 A G 4: 57,709,916 D287G probably benign Het
Pax5 A T 4: 44,645,621 V236E probably benign Het
Pcdhgb5 A G 18: 37,732,207 I352V probably benign Het
Pik3r5 A G 11: 68,494,278 T670A probably benign Het
Plxna2 T A 1: 194,796,935 N1301K possibly damaging Het
Pou5f2 G A 13: 78,025,767 G276D probably damaging Het
Ppl C G 16: 5,088,990 R1147P probably damaging Het
Prkdc C A 16: 15,727,659 R1880S probably damaging Het
Rbfox1 T A 16: 7,409,741 D373E probably benign Het
Rbm24 A G 13: 46,429,304 D233G probably damaging Het
Rbp3 A T 14: 33,958,631 E1063D possibly damaging Het
Rc3h2 A G 2: 37,377,929 V939A possibly damaging Het
Relb C A 7: 19,611,874 V385L possibly damaging Het
Robo4 T G 9: 37,405,834 S482A unknown Het
Ryr1 A C 7: 29,074,666 L2426R probably damaging Het
Sass6 A T 3: 116,613,949 E238V possibly damaging Het
Ski T C 4: 155,160,590 I400V probably benign Het
Slc27a2 C A 2: 126,574,736 A336D Het
Slc30a3 T C 5: 31,093,324 T12A possibly damaging Het
Slc6a6 T C 6: 91,748,463 V447A probably damaging Het
Smad1 T A 8: 79,371,925 I87F probably damaging Het
Spns1 G A 7: 126,372,421 S319F possibly damaging Het
Sytl3 C A 17: 6,706,011 T237N possibly damaging Het
Tdrd7 A G 4: 45,987,570 T68A probably damaging Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tmem238 A G 7: 4,789,521 C8R possibly damaging Het
Ubxn2b A T 4: 6,216,061 Q328L probably damaging Het
Vmn1r226 A G 17: 20,687,871 T122A probably benign Het
Vps13d A G 4: 145,156,078 F982L Het
Xpo4 T C 14: 57,664,910 E16G probably benign Het
Zbtb17 T A 4: 141,461,922 M51K possibly damaging Het
Zdhhc1 A G 8: 105,473,541 F315S probably benign Het
Zfp568 C T 7: 30,023,034 T468M probably damaging Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7934:Greb1l UTSW 18 10474371 nonsense probably null
R8137:Greb1l UTSW 18 10474357 missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10533060 missense probably benign 0.13
R8208:Greb1l UTSW 18 10510703 missense probably damaging 1.00
R8227:Greb1l UTSW 18 10515371 missense probably damaging 1.00
R8312:Greb1l UTSW 18 10511587 intron probably benign
R8331:Greb1l UTSW 18 10458706 missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10529687 missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10529613 missense probably benign 0.00
R8695:Greb1l UTSW 18 10544450 missense probably benign 0.01
R8795:Greb1l UTSW 18 10553739 missense probably damaging 0.98
R8862:Greb1l UTSW 18 10555042 missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10529684 missense probably benign 0.18
R8874:Greb1l UTSW 18 10544896 missense probably benign 0.01
R8886:Greb1l UTSW 18 10553843 missense probably benign 0.21
R8921:Greb1l UTSW 18 10541825 missense probably benign 0.01
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCGCACATTGCAATCTTC -3'
(R):5'- AGCGTAATTACATGGATGCTGG -3'

Sequencing Primer
(F):5'- GATTCTCGTTAACATAGGTCCTGAC -3'
(R):5'- CATGGATGCTGGAAATATCAATTGC -3'
Posted On2021-07-15