Mutagenetix > Incidental Mutation

Incidental Mutation 'R8837:Aff1'

674209

Institutional Source

Beutler Lab

Gene Symbol

Aff1

Ensembl Gene

ENSMUSG00000029313

Gene Name

AF4/FMR2 family, member 1

Synonyms

9630032B01Rik, Af4, Rob, Mllt2h

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.381) question?

Stock #

R8837 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103692374-103855322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103834212 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 739 (D739G)

Ref Sequence

ENSEMBL: ENSMUSP00000059744 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031256] [ENSMUST00000054979] [ENSMUST00000153165]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000031256
AA Change: D747G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000031256
Gene: ENSMUSG00000029313
AA Change: D747G

Domain	Start	End	E-Value	Type
Pfam:AF-4	16	1223	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000054979
AA Change: D739G

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000059744
Gene: ENSMUSG00000029313
AA Change: D739G

Domain	Start	End	E-Value	Type
Pfam:AF-4	8	1216	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000153165
AA Change: D747G

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000119631
Gene: ENSMUSG00000029313
AA Change: D747G

Domain	Start	End	E-Value	Type
Pfam:AF-4	16	871	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: This gene encodes a member of the AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome family of proteins, which have been implicated in human childhood lymphoblastic leukemia, Fragile X E site mental retardation, and ataxia. It is the prevalent mixed-lineage leukemia fusion gene associated with spontaneous acute lymphoblastic leukemia. Members of this family have three conserved domains: an N-terminal homology domain, an AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome domain, and a C-terminal homology domain. Knockout of the mouse gene by homologous recombination severely affects early events in lymphopoiesis, including precursor proliferation or recruitment, but is dispensable for terminal differentiation. In addition, an autosomal dominant missense mutation results in several phenotypes including ataxia and adult-onset Purkinje cell loss in the cerebellum, indicating a role in Purkinje cell maintenance and function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired B and T cell development. Heterozygotes for an ENU-induced mutation exhibit small size, ataxia, adult-onset Purkinje cell loss, cataracts, reduced survival, and low fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	T	G	5: 8,936,873	F764C	probably damaging	Het
Atp1a3	T	C	7: 24,978,555	Y1012C	probably damaging	Het
Btbd10	T	C	7: 113,329,926	T206A	probably benign	Het
Capn8	G	T	1: 182,628,634	A650S	possibly damaging	Het
Catsper1	A	C	19: 5,336,042	N101T	probably damaging	Het
Cdh23	A	C	10: 60,324,976	S2070R	probably benign	Het
Cep350	A	G	1: 155,861,772	V2775A	probably benign	Het
Clybl	G	A	14: 122,181,782		probably null	Het
Cog4	T	A	8: 110,852,372	N148K	probably benign	Het
Dbnl	G	A	11: 5,791,839	G44D	possibly damaging	Het
Dgcr2	A	T	16: 17,849,766	N276K	possibly damaging	Het
Dnah9	T	A	11: 65,855,234	T4018S	possibly damaging	Het
Dock3	A	G	9: 106,897,340	L72P	probably benign	Het
Fabp4	T	C	3: 10,206,045	T51A	probably benign	Het
Fam214b	A	G	4: 43,034,531	S355P	probably damaging	Het
Fars2	T	A	13: 36,246,426	I279N	probably damaging	Het
Fas	A	T	19: 34,318,649	Q164L	probably benign	Het
Focad	A	G	4: 88,154,668	K107E	probably damaging	Het
Gga3	G	A	11: 115,588,479	S338L	probably benign	Het
Grip1	A	G	10: 119,930,035	R91G	probably damaging	Het
Igkv3-7	A	G	6: 70,607,958	D94G	possibly damaging	Het
Kank3	G	C	17: 33,817,653	R165P	probably damaging	Het
Kmt2d	A	T	15: 98,864,167	L434Q	unknown	Het
Krt18	A	G	15: 102,029,830	T163A	possibly damaging	Het
Lcn10	T	A	2: 25,685,286		probably benign	Het
Lrrc37a	G	T	11: 103,503,969	P210Q	probably benign	Het
Lyst	T	A	13: 13,677,963	S2183T	probably benign	Het
Mga	G	A	2: 119,938,791		probably benign	Het
Myh9	G	A	15: 77,776,937	A818V	possibly damaging	Het
Olfr344	T	C	2: 36,568,691	I31T	probably benign	Het
Olfr906	A	T	9: 38,488,301	I91F	probably benign	Het
Olfr98	G	T	17: 37,262,916	Y249*	probably null	Het
Pde7b	A	G	10: 20,438,723		probably null	Het
Pik3cb	A	T	9: 99,054,064	Y772N	possibly damaging	Het
Ppl	C	G	16: 5,088,990	R1147P	probably damaging	Het
Prl3d2	A	T	13: 27,123,943	D69V	probably benign	Het
Psd3	A	G	8: 67,719,944	F871L	probably damaging	Het
Rlf	G	A	4: 121,188,235	P152S	probably benign	Het
Rpa1	T	C	11: 75,313,341	E270G	possibly damaging	Het
Scfd2	T	C	5: 74,530,995	T209A	probably benign	Het
Scn11a	A	G	9: 119,792,344	L669P	probably damaging	Het
Sec31b	A	T	19: 44,517,667	C933*	probably null	Het
Serpina3k	G	T	12: 104,343,033	M245I	probably benign	Het
Slc9a3	T	A	13: 74,157,704	I280N	probably damaging	Het
Soat1	A	G	1: 156,434,202	V412A	probably damaging	Het
Spata31d1a	A	T	13: 59,702,782	S511T	possibly damaging	Het
Sphkap	A	T	1: 83,275,663	V1455E	possibly damaging	Het
Spns1	G	A	7: 126,372,421	S319F	possibly damaging	Het
Tbxas1	G	T	6: 39,071,430	M403I		Het
Tln2	A	T	9: 67,250,584	C1158S	probably damaging	Het
Tnrc18	T	C	5: 142,793,056	T98A	possibly damaging	Het
Ttc23	T	C	7: 67,669,746	L118P	probably damaging	Het
Tyr	T	A	7: 87,438,015	I430L	probably damaging	Het
Uck2	A	G	1: 167,243,146	F5L	probably benign	Het
Ush2a	G	A	1: 188,753,650	V2986I	probably benign	Het
Vmn2r96	A	G	17: 18,582,626	D266G	probably benign	Het
Wdr34	T	C	2: 30,038,362	D84G	probably benign	Het
Yrdc	A	G	4: 124,853,884	D213G	probably benign	Het
Zfp612	C	A	8: 110,088,971	T270K	probably damaging	Het

Other mutations in Aff1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Aff1	APN	5	103784077	missense	probably damaging	1.00
IGL02060:Aff1	APN	5	103783849	missense	possibly damaging	0.51
IGL02081:Aff1	APN	5	103834305	missense	probably damaging	1.00
IGL02108:Aff1	APN	5	103811109	critical splice donor site	probably null
IGL03056:Aff1	APN	5	103811081	missense	probably damaging	0.99
IGL03332:Aff1	APN	5	103841105	nonsense	probably null
IGL03340:Aff1	APN	5	103783804	missense	possibly damaging	0.76
IGL03382:Aff1	APN	5	103841060	missense	possibly damaging	0.86
PIT4495001:Aff1	UTSW	5	103849525	missense	probably benign	0.16
R0013:Aff1	UTSW	5	103828484	nonsense	probably null
R0219:Aff1	UTSW	5	103811040	splice site	probably benign
R0520:Aff1	UTSW	5	103847751	nonsense	probably null
R0607:Aff1	UTSW	5	103828454	missense	probably damaging	1.00
R0883:Aff1	UTSW	5	103826138	splice site	probably benign
R1662:Aff1	UTSW	5	103841057	missense	probably damaging	0.99
R1730:Aff1	UTSW	5	103833512	missense	probably damaging	1.00
R1850:Aff1	UTSW	5	103833907	missense	probably damaging	1.00
R3411:Aff1	UTSW	5	103754706	start codon destroyed	probably null	0.53
R4007:Aff1	UTSW	5	103784222	missense	probably benign	0.15
R4207:Aff1	UTSW	5	103818988	critical splice donor site	probably null
R4702:Aff1	UTSW	5	103811069	missense	probably damaging	1.00
R4730:Aff1	UTSW	5	103843073	missense	possibly damaging	0.95
R4784:Aff1	UTSW	5	103847039	nonsense	probably null
R5166:Aff1	UTSW	5	103754657	start gained	probably benign
R5294:Aff1	UTSW	5	103811157	intron	probably benign
R5435:Aff1	UTSW	5	103754332	unclassified	probably benign
R5436:Aff1	UTSW	5	103783870	missense	probably damaging	1.00
R6065:Aff1	UTSW	5	103842252	missense	probably damaging	1.00
R6114:Aff1	UTSW	5	103842297	missense	probably damaging	0.97
R6298:Aff1	UTSW	5	103754720	missense	possibly damaging	0.68
R7095:Aff1	UTSW	5	103843085	missense	probably damaging	0.97
R7261:Aff1	UTSW	5	103828379	missense	probably damaging	0.97
R7350:Aff1	UTSW	5	103847092	missense	probably benign	0.28
R7423:Aff1	UTSW	5	103847101	missense	probably damaging	1.00
R7469:Aff1	UTSW	5	103833547	missense	probably benign	0.00
R7604:Aff1	UTSW	5	103847809	missense	probably benign	0.09
R7607:Aff1	UTSW	5	103849459	missense	possibly damaging	0.72
R8014:Aff1	UTSW	5	103833869	missense	possibly damaging	0.82
R8219:Aff1	UTSW	5	103846333	missense	probably damaging	1.00
R8315:Aff1	UTSW	5	103811090	missense	probably damaging	0.99
R8957:Aff1	UTSW	5	103833768	missense	possibly damaging	0.82
R9159:Aff1	UTSW	5	103842265	missense	possibly damaging	0.89
R9377:Aff1	UTSW	5	103833819	missense	probably damaging	0.96
R9381:Aff1	UTSW	5	103833867	missense	possibly damaging	0.85
R9705:Aff1	UTSW	5	103784410	missense	possibly damaging	0.88
R9725:Aff1	UTSW	5	103847065	missense	probably damaging	0.99
R9764:Aff1	UTSW	5	103849499	missense	probably damaging	1.00
Z1177:Aff1	UTSW	5	103783753	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- TTCCAAAGACAGACCCAAGGTG -3'
(R):5'- GACAGCTGCTTGTCTTCTGC -3'

Sequencing Primer
(F):5'- TAAGCCAGAGGTCCCTGC -3'
(R):5'- CTTCTGCTTTCCTGGGGCG -3'

Posted On

2021-07-15