Incidental Mutation 'R8837:Rpa1'
ID 674231
Institutional Source Beutler Lab
Gene Symbol Rpa1
Ensembl Gene ENSMUSG00000000751
Gene Name replication protein A1
Synonyms Rpa, 5031405K23Rik, RP-A, RF-A, 70kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8837 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 75298166-75348324 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75313341 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 270 (E270G)
Ref Sequence ENSEMBL: ENSMUSP00000000767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000767] [ENSMUST00000092907]
AlphaFold Q8VEE4
Predicted Effect possibly damaging
Transcript: ENSMUST00000000767
AA Change: E270G

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000000767
Gene: ENSMUSG00000000751
AA Change: E270G

DomainStartEndE-ValueType
Pfam:Rep-A_N 5 93 7.2e-30 PFAM
low complexity region 145 175 N/A INTRINSIC
Pfam:tRNA_anti-codon 227 316 5e-13 PFAM
Pfam:REPA_OB_2 335 432 5e-37 PFAM
Pfam:Rep_fac-A_C 491 636 4.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092907
AA Change: E249G

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000090585
Gene: ENSMUSG00000000751
AA Change: E249G

DomainStartEndE-ValueType
Pfam:Rep-A_N 5 104 4.3e-35 PFAM
low complexity region 124 154 N/A INTRINSIC
Pfam:tRNA_anti-codon 206 295 8.4e-13 PFAM
SCOP:d1fgua2 308 435 8e-46 SMART
Pfam:Rep_fac-A_C 470 615 9.2e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality before implantation and impaired cell proliferation. Heterozygous null mice display decreased survival, chromosomal instability, impaired double strand break repair, and develop lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T G 5: 8,936,873 F764C probably damaging Het
Aff1 A G 5: 103,834,212 D739G possibly damaging Het
Atp1a3 T C 7: 24,978,555 Y1012C probably damaging Het
Btbd10 T C 7: 113,329,926 T206A probably benign Het
Capn8 G T 1: 182,628,634 A650S possibly damaging Het
Catsper1 A C 19: 5,336,042 N101T probably damaging Het
Cdh23 A C 10: 60,324,976 S2070R probably benign Het
Cep350 A G 1: 155,861,772 V2775A probably benign Het
Clybl G A 14: 122,181,782 probably null Het
Cog4 T A 8: 110,852,372 N148K probably benign Het
Dbnl G A 11: 5,791,839 G44D possibly damaging Het
Dgcr2 A T 16: 17,849,766 N276K possibly damaging Het
Dnah9 T A 11: 65,855,234 T4018S possibly damaging Het
Dock3 A G 9: 106,897,340 L72P probably benign Het
Fabp4 T C 3: 10,206,045 T51A probably benign Het
Fam214b A G 4: 43,034,531 S355P probably damaging Het
Fars2 T A 13: 36,246,426 I279N probably damaging Het
Fas A T 19: 34,318,649 Q164L probably benign Het
Focad A G 4: 88,154,668 K107E probably damaging Het
Gga3 G A 11: 115,588,479 S338L probably benign Het
Grip1 A G 10: 119,930,035 R91G probably damaging Het
Igkv3-7 A G 6: 70,607,958 D94G possibly damaging Het
Kank3 G C 17: 33,817,653 R165P probably damaging Het
Kmt2d A T 15: 98,864,167 L434Q unknown Het
Krt18 A G 15: 102,029,830 T163A possibly damaging Het
Lcn10 T A 2: 25,685,286 probably benign Het
Lrrc37a G T 11: 103,503,969 P210Q probably benign Het
Lyst T A 13: 13,677,963 S2183T probably benign Het
Mga G A 2: 119,938,791 probably benign Het
Myh9 G A 15: 77,776,937 A818V possibly damaging Het
Olfr344 T C 2: 36,568,691 I31T probably benign Het
Olfr906 A T 9: 38,488,301 I91F probably benign Het
Olfr98 G T 17: 37,262,916 Y249* probably null Het
Pde7b A G 10: 20,438,723 probably null Het
Pik3cb A T 9: 99,054,064 Y772N possibly damaging Het
Ppl C G 16: 5,088,990 R1147P probably damaging Het
Prl3d2 A T 13: 27,123,943 D69V probably benign Het
Psd3 A G 8: 67,719,944 F871L probably damaging Het
Rlf G A 4: 121,188,235 P152S probably benign Het
Scfd2 T C 5: 74,530,995 T209A probably benign Het
Scn11a A G 9: 119,792,344 L669P probably damaging Het
Sec31b A T 19: 44,517,667 C933* probably null Het
Serpina3k G T 12: 104,343,033 M245I probably benign Het
Slc9a3 T A 13: 74,157,704 I280N probably damaging Het
Soat1 A G 1: 156,434,202 V412A probably damaging Het
Spata31d1a A T 13: 59,702,782 S511T possibly damaging Het
Sphkap A T 1: 83,275,663 V1455E possibly damaging Het
Spns1 G A 7: 126,372,421 S319F possibly damaging Het
Tbxas1 G T 6: 39,071,430 M403I Het
Tln2 A T 9: 67,250,584 C1158S probably damaging Het
Tnrc18 T C 5: 142,793,056 T98A possibly damaging Het
Ttc23 T C 7: 67,669,746 L118P probably damaging Het
Tyr T A 7: 87,438,015 I430L probably damaging Het
Uck2 A G 1: 167,243,146 F5L probably benign Het
Ush2a G A 1: 188,753,650 V2986I probably benign Het
Vmn2r96 A G 17: 18,582,626 D266G probably benign Het
Wdr34 T C 2: 30,038,362 D84G probably benign Het
Yrdc A G 4: 124,853,884 D213G probably benign Het
Zfp612 C A 8: 110,088,971 T270K probably damaging Het
Other mutations in Rpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Rpa1 APN 11 75312315 missense probably damaging 1.00
IGL01347:Rpa1 APN 11 75307285 missense probably damaging 1.00
IGL02976:Rpa1 APN 11 75312802 missense probably damaging 0.99
IGL03169:Rpa1 APN 11 75301357 missense probably damaging 0.97
nonnae UTSW 11 75314895 missense probably damaging 1.00
R6762_Rpa1_753 UTSW 11 75340345 missense possibly damaging 0.89
FR4976:Rpa1 UTSW 11 75318519 small deletion probably benign
PIT4576001:Rpa1 UTSW 11 75313158 missense probably damaging 1.00
R0017:Rpa1 UTSW 11 75314861 missense probably null 1.00
R0017:Rpa1 UTSW 11 75314861 missense probably null 1.00
R0126:Rpa1 UTSW 11 75318529 missense probably benign 0.00
R0240:Rpa1 UTSW 11 75328687 missense probably benign 0.01
R0240:Rpa1 UTSW 11 75328687 missense probably benign 0.01
R0465:Rpa1 UTSW 11 75313095 missense probably damaging 0.99
R0718:Rpa1 UTSW 11 75318401 splice site probably benign
R0973:Rpa1 UTSW 11 75312973 splice site probably null
R1055:Rpa1 UTSW 11 75302732 missense probably damaging 1.00
R1172:Rpa1 UTSW 11 75312393 missense probably damaging 1.00
R1642:Rpa1 UTSW 11 75312691 critical splice donor site probably null
R1883:Rpa1 UTSW 11 75318483 missense probably benign
R1975:Rpa1 UTSW 11 75306176 missense probably damaging 1.00
R5008:Rpa1 UTSW 11 75313299 critical splice donor site probably null
R5279:Rpa1 UTSW 11 75313344 missense probably damaging 0.96
R6083:Rpa1 UTSW 11 75314911 missense probably damaging 1.00
R6161:Rpa1 UTSW 11 75314895 missense probably damaging 1.00
R6187:Rpa1 UTSW 11 75310236 missense probably benign 0.00
R6762:Rpa1 UTSW 11 75340345 missense possibly damaging 0.89
R6828:Rpa1 UTSW 11 75314871 missense probably damaging 1.00
R7044:Rpa1 UTSW 11 75312802 missense probably damaging 0.99
R7331:Rpa1 UTSW 11 75313115 missense probably damaging 0.98
R7798:Rpa1 UTSW 11 75312809 missense probably damaging 0.96
R7890:Rpa1 UTSW 11 75307224 frame shift probably null
R7938:Rpa1 UTSW 11 75307224 frame shift probably null
R8116:Rpa1 UTSW 11 75302675 missense possibly damaging 0.90
R8258:Rpa1 UTSW 11 75302724 missense probably benign 0.03
R8259:Rpa1 UTSW 11 75302724 missense probably benign 0.03
R9169:Rpa1 UTSW 11 75310173 nonsense probably null
RF018:Rpa1 UTSW 11 75318517 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTTAGCGATCTTCAGGGCG -3'
(R):5'- ACTGTATATGTGGGATTCTGCAATG -3'

Sequencing Primer
(F):5'- GCGCCCTTTGAGAAGTAATAC -3'
(R):5'- AATGTCTGCAGCCCTGTGAG -3'
Posted On 2021-07-15