Mutagenetix > Incidental Mutations

Incidental Mutation 'R8837:Slc9a3'

674239

Institutional Source

Beutler Lab

Gene Symbol

Slc9a3

Ensembl Gene

ENSMUSG00000036123

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 3

Synonyms

9030624O13Rik, NHE-3, NHE3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8837 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74121457-74169442 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 74157704 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 280 (I280N)

Ref Sequence

ENSEMBL: ENSMUSP00000038142 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036208] [ENSMUST00000221703] [ENSMUST00000225423]

AlphaFold

G3X939

Predicted Effect

probably damaging
Transcript: ENSMUST00000036208
AA Change: I280N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: I280N

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Na_H_Exchanger	53	457	3.6e-87	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000221703
AA Change: I280N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225423
AA Change: I280N

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	T	G	5: 8,936,873	F764C	probably damaging	Het
Aff1	A	G	5: 103,834,212	D739G	possibly damaging	Het
Atp1a3	T	C	7: 24,978,555	Y1012C	probably damaging	Het
Btbd10	T	C	7: 113,329,926	T206A	probably benign	Het
Capn8	G	T	1: 182,628,634	A650S	possibly damaging	Het
Catsper1	A	C	19: 5,336,042	N101T	probably damaging	Het
Cdh23	A	C	10: 60,324,976	S2070R	probably benign	Het
Cep350	A	G	1: 155,861,772	V2775A	probably benign	Het
Clybl	G	A	14: 122,181,782		probably null	Het
Cog4	T	A	8: 110,852,372	N148K	probably benign	Het
Dbnl	G	A	11: 5,791,839	G44D	possibly damaging	Het
Dgcr2	A	T	16: 17,849,766	N276K	possibly damaging	Het
Dnah9	T	A	11: 65,855,234	T4018S	possibly damaging	Het
Dock3	A	G	9: 106,897,340	L72P	probably benign	Het
Fabp4	T	C	3: 10,206,045	T51A	probably benign	Het
Fam214b	A	G	4: 43,034,531	S355P	probably damaging	Het
Fars2	T	A	13: 36,246,426	I279N	probably damaging	Het
Fas	A	T	19: 34,318,649	Q164L	probably benign	Het
Focad	A	G	4: 88,154,668	K107E	probably damaging	Het
Gga3	G	A	11: 115,588,479	S338L	probably benign	Het
Grip1	A	G	10: 119,930,035	R91G	probably damaging	Het
Igkv3-7	A	G	6: 70,607,958	D94G	possibly damaging	Het
Kank3	G	C	17: 33,817,653	R165P	probably damaging	Het
Kmt2d	A	T	15: 98,864,167	L434Q	unknown	Het
Krt18	A	G	15: 102,029,830	T163A	possibly damaging	Het
Lcn10	T	A	2: 25,685,286		probably benign	Het
Lrrc37a	G	T	11: 103,503,969	P210Q	probably benign	Het
Lyst	T	A	13: 13,677,963	S2183T	probably benign	Het
Mga	G	A	2: 119,938,791		probably benign	Het
Myh9	G	A	15: 77,776,937	A818V	possibly damaging	Het
Olfr344	T	C	2: 36,568,691	I31T	probably benign	Het
Olfr906	A	T	9: 38,488,301	I91F	probably benign	Het
Olfr98	G	T	17: 37,262,916	Y249*	probably null	Het
Pde7b	A	G	10: 20,438,723		probably null	Het
Pik3cb	A	T	9: 99,054,064	Y772N	possibly damaging	Het
Ppl	C	G	16: 5,088,990	R1147P	probably damaging	Het
Prl3d2	A	T	13: 27,123,943	D69V	probably benign	Het
Psd3	A	G	8: 67,719,944	F871L	probably damaging	Het
Rlf	G	A	4: 121,188,235	P152S	probably benign	Het
Rpa1	T	C	11: 75,313,341	E270G	possibly damaging	Het
Scfd2	T	C	5: 74,530,995	T209A	probably benign	Het
Scn11a	A	G	9: 119,792,344	L669P	probably damaging	Het
Sec31b	A	T	19: 44,517,667	C933*	probably null	Het
Serpina3k	G	T	12: 104,343,033	M245I	probably benign	Het
Soat1	A	G	1: 156,434,202	V412A	probably damaging	Het
Spata31d1a	A	T	13: 59,702,782	S511T	possibly damaging	Het
Sphkap	A	T	1: 83,275,663	V1455E	possibly damaging	Het
Spns1	G	A	7: 126,372,421	S319F	possibly damaging	Het
Tbxas1	G	T	6: 39,071,430	M403I		Het
Tln2	A	T	9: 67,250,584	C1158S	probably damaging	Het
Tnrc18	T	C	5: 142,793,056	T98A	possibly damaging	Het
Ttc23	T	C	7: 67,669,746	L118P	probably damaging	Het
Tyr	T	A	7: 87,438,015	I430L	probably damaging	Het
Uck2	A	G	1: 167,243,146	F5L	probably benign	Het
Ush2a	G	A	1: 188,753,650	V2986I	probably benign	Het
Vmn2r96	A	G	17: 18,582,626	D266G	probably benign	Het
Wdr34	T	C	2: 30,038,362	D84G	probably benign	Het
Yrdc	A	G	4: 124,853,884	D213G	probably benign	Het
Zfp612	C	A	8: 110,088,971	T270K	probably damaging	Het

Other mutations in Slc9a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Slc9a3	APN	13	74160302	missense	probably benign	0.19
IGL01299:Slc9a3	APN	13	74160263	missense	probably benign	0.33
IGL01390:Slc9a3	APN	13	74150761	missense	probably benign	0.01
IGL01814:Slc9a3	APN	13	74165972	missense	probably damaging	0.96
IGL02020:Slc9a3	APN	13	74158848	missense	probably damaging	0.99
IGL02072:Slc9a3	APN	13	74165859	missense	probably benign	0.00
IGL02186:Slc9a3	APN	13	74163114	missense	possibly damaging	0.94
IGL02878:Slc9a3	APN	13	74165357	nonsense	probably null
IGL03056:Slc9a3	APN	13	74150819	missense	probably damaging	1.00
R0090:Slc9a3	UTSW	13	74158728	missense	probably damaging	0.99
R0280:Slc9a3	UTSW	13	74159424	missense	probably damaging	1.00
R0359:Slc9a3	UTSW	13	74157607	missense	probably damaging	1.00
R0388:Slc9a3	UTSW	13	74121536	missense	unknown
R0396:Slc9a3	UTSW	13	74157784	critical splice donor site	probably null
R0893:Slc9a3	UTSW	13	74159246	missense	probably damaging	1.00
R1169:Slc9a3	UTSW	13	74150743	missense	probably damaging	0.98
R1640:Slc9a3	UTSW	13	74158818	missense	probably damaging	1.00
R1769:Slc9a3	UTSW	13	74163071	missense	probably benign	0.00
R1850:Slc9a3	UTSW	13	74161770	missense	probably benign	0.34
R1937:Slc9a3	UTSW	13	74166056	splice site	probably null
R2048:Slc9a3	UTSW	13	74163741	missense	probably damaging	1.00
R2146:Slc9a3	UTSW	13	74121603	missense	probably benign	0.00
R2495:Slc9a3	UTSW	13	74158703	missense	probably damaging	0.99
R2883:Slc9a3	UTSW	13	74158760	missense	probably damaging	1.00
R2938:Slc9a3	UTSW	13	74121669	missense	possibly damaging	0.62
R4538:Slc9a3	UTSW	13	74161732	missense	possibly damaging	0.56
R4580:Slc9a3	UTSW	13	74158886	nonsense	probably null
R4581:Slc9a3	UTSW	13	74164165	missense	probably damaging	0.99
R4841:Slc9a3	UTSW	13	74165837	missense	probably damaging	1.00
R4928:Slc9a3	UTSW	13	74157719	missense	probably damaging	1.00
R4965:Slc9a3	UTSW	13	74164293	missense	possibly damaging	0.62
R5079:Slc9a3	UTSW	13	74164287	missense	probably damaging	0.97
R5329:Slc9a3	UTSW	13	74150960	missense	possibly damaging	0.94
R5663:Slc9a3	UTSW	13	74163712	missense	probably damaging	0.98
R5876:Slc9a3	UTSW	13	74161723	missense	probably damaging	1.00
R5919:Slc9a3	UTSW	13	74158740	missense	probably damaging	0.98
R6060:Slc9a3	UTSW	13	74150885	missense	probably damaging	1.00
R6562:Slc9a3	UTSW	13	74155161	missense	probably damaging	1.00
R6645:Slc9a3	UTSW	13	74164172	missense	probably damaging	0.99
R7145:Slc9a3	UTSW	13	74150678	missense	probably damaging	0.99
R7422:Slc9a3	UTSW	13	74150885	missense	probably damaging	1.00
R7565:Slc9a3	UTSW	13	74157694	missense	probably damaging	1.00
R7679:Slc9a3	UTSW	13	74160276	missense	possibly damaging	0.88
R8032:Slc9a3	UTSW	13	74157644	missense	probably damaging	1.00
R8080:Slc9a3	UTSW	13	74166027	missense	probably benign	0.30
R8158:Slc9a3	UTSW	13	74155122	missense	probably damaging	1.00
R8159:Slc9a3	UTSW	13	74164288	missense	probably benign	0.01
R8939:Slc9a3	UTSW	13	74163776	missense	possibly damaging	0.93
R9111:Slc9a3	UTSW	13	74150801	missense	probably damaging	1.00
Z1176:Slc9a3	UTSW	13	74165856	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTGCCAGGAGCTTTCCATG -3'
(R):5'- GATACCCTCTGCTCACAGTG -3'

Sequencing Primer
(F):5'- TCCATGGGGAATGAGTAGCC -3'
(R):5'- CCTTCTGCCGGAGTTTAAATGCAG -3'

Posted On

2021-07-15