Incidental Mutation 'R8837:Slc9a3'
ID 674239
Institutional Source Beutler Lab
Gene Symbol Slc9a3
Ensembl Gene ENSMUSG00000036123
Gene Name solute carrier family 9 (sodium/hydrogen exchanger), member 3
Synonyms 9030624O13Rik, NHE-3, NHE3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8837 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 74121457-74169442 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74157704 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 280 (I280N)
Ref Sequence ENSEMBL: ENSMUSP00000038142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036208] [ENSMUST00000221703] [ENSMUST00000225423]
AlphaFold G3X939
Predicted Effect probably damaging
Transcript: ENSMUST00000036208
AA Change: I280N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: I280N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_H_Exchanger 53 457 3.6e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221703
AA Change: I280N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225423
AA Change: I280N

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T G 5: 8,936,873 F764C probably damaging Het
Aff1 A G 5: 103,834,212 D739G possibly damaging Het
Atp1a3 T C 7: 24,978,555 Y1012C probably damaging Het
Btbd10 T C 7: 113,329,926 T206A probably benign Het
Capn8 G T 1: 182,628,634 A650S possibly damaging Het
Catsper1 A C 19: 5,336,042 N101T probably damaging Het
Cdh23 A C 10: 60,324,976 S2070R probably benign Het
Cep350 A G 1: 155,861,772 V2775A probably benign Het
Clybl G A 14: 122,181,782 probably null Het
Cog4 T A 8: 110,852,372 N148K probably benign Het
Dbnl G A 11: 5,791,839 G44D possibly damaging Het
Dgcr2 A T 16: 17,849,766 N276K possibly damaging Het
Dnah9 T A 11: 65,855,234 T4018S possibly damaging Het
Dock3 A G 9: 106,897,340 L72P probably benign Het
Fabp4 T C 3: 10,206,045 T51A probably benign Het
Fam214b A G 4: 43,034,531 S355P probably damaging Het
Fars2 T A 13: 36,246,426 I279N probably damaging Het
Fas A T 19: 34,318,649 Q164L probably benign Het
Focad A G 4: 88,154,668 K107E probably damaging Het
Gga3 G A 11: 115,588,479 S338L probably benign Het
Grip1 A G 10: 119,930,035 R91G probably damaging Het
Igkv3-7 A G 6: 70,607,958 D94G possibly damaging Het
Kank3 G C 17: 33,817,653 R165P probably damaging Het
Kmt2d A T 15: 98,864,167 L434Q unknown Het
Krt18 A G 15: 102,029,830 T163A possibly damaging Het
Lcn10 T A 2: 25,685,286 probably benign Het
Lrrc37a G T 11: 103,503,969 P210Q probably benign Het
Lyst T A 13: 13,677,963 S2183T probably benign Het
Mga G A 2: 119,938,791 probably benign Het
Myh9 G A 15: 77,776,937 A818V possibly damaging Het
Olfr344 T C 2: 36,568,691 I31T probably benign Het
Olfr906 A T 9: 38,488,301 I91F probably benign Het
Olfr98 G T 17: 37,262,916 Y249* probably null Het
Pde7b A G 10: 20,438,723 probably null Het
Pik3cb A T 9: 99,054,064 Y772N possibly damaging Het
Ppl C G 16: 5,088,990 R1147P probably damaging Het
Prl3d2 A T 13: 27,123,943 D69V probably benign Het
Psd3 A G 8: 67,719,944 F871L probably damaging Het
Rlf G A 4: 121,188,235 P152S probably benign Het
Rpa1 T C 11: 75,313,341 E270G possibly damaging Het
Scfd2 T C 5: 74,530,995 T209A probably benign Het
Scn11a A G 9: 119,792,344 L669P probably damaging Het
Sec31b A T 19: 44,517,667 C933* probably null Het
Serpina3k G T 12: 104,343,033 M245I probably benign Het
Soat1 A G 1: 156,434,202 V412A probably damaging Het
Spata31d1a A T 13: 59,702,782 S511T possibly damaging Het
Sphkap A T 1: 83,275,663 V1455E possibly damaging Het
Spns1 G A 7: 126,372,421 S319F possibly damaging Het
Tbxas1 G T 6: 39,071,430 M403I Het
Tln2 A T 9: 67,250,584 C1158S probably damaging Het
Tnrc18 T C 5: 142,793,056 T98A possibly damaging Het
Ttc23 T C 7: 67,669,746 L118P probably damaging Het
Tyr T A 7: 87,438,015 I430L probably damaging Het
Uck2 A G 1: 167,243,146 F5L probably benign Het
Ush2a G A 1: 188,753,650 V2986I probably benign Het
Vmn2r96 A G 17: 18,582,626 D266G probably benign Het
Wdr34 T C 2: 30,038,362 D84G probably benign Het
Yrdc A G 4: 124,853,884 D213G probably benign Het
Zfp612 C A 8: 110,088,971 T270K probably damaging Het
Other mutations in Slc9a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Slc9a3 APN 13 74160302 missense probably benign 0.19
IGL01299:Slc9a3 APN 13 74160263 missense probably benign 0.33
IGL01390:Slc9a3 APN 13 74150761 missense probably benign 0.01
IGL01814:Slc9a3 APN 13 74165972 missense probably damaging 0.96
IGL02020:Slc9a3 APN 13 74158848 missense probably damaging 0.99
IGL02072:Slc9a3 APN 13 74165859 missense probably benign 0.00
IGL02186:Slc9a3 APN 13 74163114 missense possibly damaging 0.94
IGL02878:Slc9a3 APN 13 74165357 nonsense probably null
IGL03056:Slc9a3 APN 13 74150819 missense probably damaging 1.00
R0090:Slc9a3 UTSW 13 74158728 missense probably damaging 0.99
R0280:Slc9a3 UTSW 13 74159424 missense probably damaging 1.00
R0359:Slc9a3 UTSW 13 74157607 missense probably damaging 1.00
R0388:Slc9a3 UTSW 13 74121536 missense unknown
R0396:Slc9a3 UTSW 13 74157784 critical splice donor site probably null
R0893:Slc9a3 UTSW 13 74159246 missense probably damaging 1.00
R1169:Slc9a3 UTSW 13 74150743 missense probably damaging 0.98
R1640:Slc9a3 UTSW 13 74158818 missense probably damaging 1.00
R1769:Slc9a3 UTSW 13 74163071 missense probably benign 0.00
R1850:Slc9a3 UTSW 13 74161770 missense probably benign 0.34
R1937:Slc9a3 UTSW 13 74166056 splice site probably null
R2048:Slc9a3 UTSW 13 74163741 missense probably damaging 1.00
R2146:Slc9a3 UTSW 13 74121603 missense probably benign 0.00
R2495:Slc9a3 UTSW 13 74158703 missense probably damaging 0.99
R2883:Slc9a3 UTSW 13 74158760 missense probably damaging 1.00
R2938:Slc9a3 UTSW 13 74121669 missense possibly damaging 0.62
R4538:Slc9a3 UTSW 13 74161732 missense possibly damaging 0.56
R4580:Slc9a3 UTSW 13 74158886 nonsense probably null
R4581:Slc9a3 UTSW 13 74164165 missense probably damaging 0.99
R4841:Slc9a3 UTSW 13 74165837 missense probably damaging 1.00
R4928:Slc9a3 UTSW 13 74157719 missense probably damaging 1.00
R4965:Slc9a3 UTSW 13 74164293 missense possibly damaging 0.62
R5079:Slc9a3 UTSW 13 74164287 missense probably damaging 0.97
R5329:Slc9a3 UTSW 13 74150960 missense possibly damaging 0.94
R5663:Slc9a3 UTSW 13 74163712 missense probably damaging 0.98
R5876:Slc9a3 UTSW 13 74161723 missense probably damaging 1.00
R5919:Slc9a3 UTSW 13 74158740 missense probably damaging 0.98
R6060:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R6562:Slc9a3 UTSW 13 74155161 missense probably damaging 1.00
R6645:Slc9a3 UTSW 13 74164172 missense probably damaging 0.99
R7145:Slc9a3 UTSW 13 74150678 missense probably damaging 0.99
R7422:Slc9a3 UTSW 13 74150885 missense probably damaging 1.00
R7565:Slc9a3 UTSW 13 74157694 missense probably damaging 1.00
R7679:Slc9a3 UTSW 13 74160276 missense possibly damaging 0.88
R8032:Slc9a3 UTSW 13 74157644 missense probably damaging 1.00
R8080:Slc9a3 UTSW 13 74166027 missense probably benign 0.30
R8158:Slc9a3 UTSW 13 74155122 missense probably damaging 1.00
R8159:Slc9a3 UTSW 13 74164288 missense probably benign 0.01
R8939:Slc9a3 UTSW 13 74163776 missense possibly damaging 0.93
R9111:Slc9a3 UTSW 13 74150801 missense probably damaging 1.00
Z1176:Slc9a3 UTSW 13 74165856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCCAGGAGCTTTCCATG -3'
(R):5'- GATACCCTCTGCTCACAGTG -3'

Sequencing Primer
(F):5'- TCCATGGGGAATGAGTAGCC -3'
(R):5'- CCTTCTGCCGGAGTTTAAATGCAG -3'
Posted On 2021-07-15