Incidental Mutation 'R0729:Pcdh12'
ID67424
Institutional Source Beutler Lab
Gene Symbol Pcdh12
Ensembl Gene ENSMUSG00000024440
Gene Nameprotocadherin 12
SynonymsVE-cadherin-2, vascular endothelial cadherin-2
MMRRC Submission 038910-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0729 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location38267092-38284402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38282464 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 536 (I536T)
Ref Sequence ENSEMBL: ENSMUSP00000025311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025311] [ENSMUST00000194012]
Predicted Effect probably benign
Transcript: ENSMUST00000025311
AA Change: I536T

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000025311
Gene: ENSMUSG00000024440
AA Change: I536T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CA 53 133 4.42e-2 SMART
CA 157 242 2.55e-17 SMART
CA 266 350 2.31e-24 SMART
CA 376 458 3.86e-26 SMART
CA 482 563 6.27e-26 SMART
CA 621 704 3.02e-2 SMART
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 960 975 N/A INTRINSIC
low complexity region 1032 1041 N/A INTRINSIC
low complexity region 1115 1125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193123
Predicted Effect probably benign
Transcript: ENSMUST00000194012
SMART Domains Protein: ENSMUSP00000141907
Gene: ENSMUSG00000024440

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195747
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein consists of an extracellular domain containing 6 cadherin repeats, a transmembrane domain and a cytoplasmic tail that differs from those of the classical cadherins. The gene localizes to the region on chromosome 5 where the protocadherin gene clusters reside. The exon organization of this transcript is similar to that of the gene cluster transcripts, notably the first large exon, but no significant sequence homology exists. The function of this cellular adhesion protein is undetermined but mouse protocadherin 12 does not bind catenins and appears to have no affect on cell migration or growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable, fertile and do not display any obvious histomorphological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C A 11: 72,159,455 A828S probably benign Het
Acsm3 T C 7: 119,783,984 probably benign Het
Adamts12 G A 15: 11,255,683 R446H possibly damaging Het
Adgrb1 A G 15: 74,548,549 N849S probably damaging Het
Ankra2 A G 13: 98,271,727 D228G probably damaging Het
Bicd1 T C 6: 149,512,914 V375A probably damaging Het
Blvrb A G 7: 27,448,130 K5E possibly damaging Het
Cacna2d2 A G 9: 107,517,257 N573D probably benign Het
Calhm2 C A 19: 47,132,917 G271V possibly damaging Het
Capn13 C T 17: 73,322,069 G581E probably damaging Het
Capzb T C 4: 139,288,977 probably benign Het
Casd1 T C 6: 4,619,753 probably benign Het
Clca4b A G 3: 144,928,350 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crx A G 7: 15,871,133 probably benign Het
Cyp2c68 T C 19: 39,739,550 probably benign Het
Dcaf8 T A 1: 172,172,654 D126E probably benign Het
Ddx31 T C 2: 28,874,174 I464T probably damaging Het
Dhx32 G A 7: 133,737,421 T155I probably benign Het
Elac2 C A 11: 64,998,523 P567T possibly damaging Het
Fat4 A G 3: 39,000,295 probably benign Het
Fh1 T G 1: 175,614,817 N156H probably damaging Het
Gm10064 T C 5: 122,697,521 noncoding transcript Het
Gm14137 A G 2: 119,175,353 E131G probably benign Het
Gpr22 T A 12: 31,709,313 K233M probably damaging Het
Gpr63 A G 4: 25,007,480 N68S probably benign Het
Gypa C T 8: 80,496,792 P66S unknown Het
Htr2a A T 14: 74,642,147 Q72L probably benign Het
Klhdc7b C T 15: 89,387,395 R827* probably null Het
Leo1 G A 9: 75,457,138 R520Q possibly damaging Het
Lrrc66 T C 5: 73,608,414 M429V probably benign Het
Lrrc74a C T 12: 86,745,579 Q225* probably null Het
Mamdc4 T A 2: 25,570,036 N68Y probably damaging Het
Map3k10 G A 7: 27,661,567 P507L probably damaging Het
Methig1 T A 15: 100,374,989 C68S probably benign Het
Metrn C T 17: 25,796,228 probably benign Het
Mmp12 C T 9: 7,358,290 T392I possibly damaging Het
Mss51 A T 14: 20,483,092 I437N probably damaging Het
Mtus2 A G 5: 148,077,287 T297A probably benign Het
Myo10 T C 15: 25,722,157 probably benign Het
Ncoa7 G A 10: 30,691,579 P319S probably benign Het
Nlrp4d A T 7: 10,377,685 probably benign Het
Obscn A G 11: 59,032,709 S6455P probably damaging Het
Olfr1447 T C 19: 12,900,895 N295S probably damaging Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Pex5l G T 3: 32,954,536 probably benign Het
Pla2g2e A C 4: 138,880,735 K43Q possibly damaging Het
Rasa4 T C 5: 136,102,070 probably benign Het
Rsf1 C T 7: 97,679,027 R1079W probably damaging Het
Sez6 A G 11: 77,976,585 T803A probably benign Het
Shcbp1 T A 8: 4,736,297 N602Y probably benign Het
Slc16a13 G A 11: 70,219,031 P215S probably damaging Het
Slc39a6 T C 18: 24,601,470 Q54R probably benign Het
Smg1 C A 7: 118,146,289 probably benign Het
Spg7 A G 8: 123,070,417 N110D probably damaging Het
Sptbn1 A T 11: 30,110,902 S2010T probably damaging Het
Sun1 T A 5: 139,237,864 probably benign Het
Sytl5 A G X: 9,994,497 E717G probably damaging Het
Tle1 A T 4: 72,126,442 probably benign Het
Tm9sf4 T A 2: 153,191,145 V290E probably damaging Het
Tmem63b A G 17: 45,674,134 S179P probably damaging Het
Trpm3 T A 19: 22,987,789 F1549L probably benign Het
Ubr4 A T 4: 139,485,320 Y5063F possibly damaging Het
Uroc1 T A 6: 90,336,955 Y75N probably damaging Het
Vmn2r70 T C 7: 85,565,904 T141A probably benign Het
Vps13c A G 9: 67,961,649 K3128E probably damaging Het
Wdr26 T C 1: 181,185,905 probably null Het
Wrn T A 8: 33,248,918 probably null Het
Zfp106 C T 2: 120,555,248 V13M probably damaging Het
Zfp456 G A 13: 67,366,544 H348Y probably damaging Het
Zfpm1 G A 8: 122,336,659 R819H probably benign Het
Other mutations in Pcdh12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcdh12 APN 18 38281457 missense probably benign
IGL00964:Pcdh12 APN 18 38282731 missense probably benign 0.27
IGL01105:Pcdh12 APN 18 38275347 missense probably damaging 1.00
IGL02011:Pcdh12 APN 18 38281420 missense probably damaging 1.00
IGL02234:Pcdh12 APN 18 38283535 missense probably damaging 1.00
IGL02452:Pcdh12 APN 18 38281693 missense probably benign 0.00
IGL03412:Pcdh12 APN 18 38283515 missense probably benign 0.24
R1330:Pcdh12 UTSW 18 38281861 missense probably benign 0.13
R1394:Pcdh12 UTSW 18 38281189 critical splice donor site probably null
R1413:Pcdh12 UTSW 18 38283443 missense probably damaging 1.00
R1993:Pcdh12 UTSW 18 38282143 missense possibly damaging 0.62
R2115:Pcdh12 UTSW 18 38283986 missense probably damaging 1.00
R2567:Pcdh12 UTSW 18 38282096 missense probably damaging 1.00
R2926:Pcdh12 UTSW 18 38282390 missense probably damaging 0.99
R3810:Pcdh12 UTSW 18 38281237 missense probably damaging 1.00
R3813:Pcdh12 UTSW 18 38283614 nonsense probably null
R5275:Pcdh12 UTSW 18 38284101 utr 5 prime probably benign
R5400:Pcdh12 UTSW 18 38268898 missense probably damaging 1.00
R5523:Pcdh12 UTSW 18 38283139 missense probably damaging 1.00
R5539:Pcdh12 UTSW 18 38281744 missense possibly damaging 0.77
R5604:Pcdh12 UTSW 18 38268882 missense probably damaging 1.00
R6012:Pcdh12 UTSW 18 38283752 missense probably damaging 1.00
R6042:Pcdh12 UTSW 18 38281505 missense probably damaging 1.00
R6129:Pcdh12 UTSW 18 38277859 missense probably damaging 1.00
R6239:Pcdh12 UTSW 18 38282401 missense probably damaging 1.00
R6508:Pcdh12 UTSW 18 38281337 nonsense probably null
R7250:Pcdh12 UTSW 18 38281976 missense probably benign
R7259:Pcdh12 UTSW 18 38281624 missense probably benign 0.00
R7271:Pcdh12 UTSW 18 38283047 missense probably damaging 1.00
R7489:Pcdh12 UTSW 18 38281789 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGGAGGCATTTACAAGCACCGAAAG -3'
(R):5'- TGTTTGCCCAAGACCAAGGACC -3'

Sequencing Primer
(F):5'- CACCGAAAGGGTGGCTTTG -3'
(R):5'- GTCAATGACAATGCCCCTGTG -3'
Posted On2013-09-03