Incidental Mutation 'R8837:Sec31b'
ID674251
Institutional Source Beutler Lab
Gene Symbol Sec31b
Ensembl Gene ENSMUSG00000051984
Gene NameSec31 homolog B (S. cerevisiae)
SynonymsLOC240667, Sec31l2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R8837 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location44516957-44545864 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 44517667 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 933 (C933*)
Ref Sequence ENSEMBL: ENSMUSP00000107616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041163] [ENSMUST00000063632] [ENSMUST00000111985]
Predicted Effect probably benign
Transcript: ENSMUST00000041163
SMART Domains Protein: ENSMUSP00000042867
Gene: ENSMUSG00000036961

DomainStartEndE-ValueType
WNT1 38 351 1.02e-185 SMART
Predicted Effect probably null
Transcript: ENSMUST00000063632
AA Change: C1090*
SMART Domains Protein: ENSMUSP00000064900
Gene: ENSMUSG00000051984
AA Change: C1090*

DomainStartEndE-ValueType
Blast:WD40 56 101 5e-18 BLAST
WD40 110 150 4.76e-6 SMART
WD40 159 197 1.53e1 SMART
WD40 200 245 1.85e0 SMART
WD40 249 289 2.15e-4 SMART
WD40 292 332 6.19e-1 SMART
low complexity region 551 561 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 909 929 N/A INTRINSIC
low complexity region 1009 1018 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111985
AA Change: C933*
SMART Domains Protein: ENSMUSP00000107616
Gene: ENSMUSG00000051984
AA Change: C933*

DomainStartEndE-ValueType
WD40 2 40 1.53e1 SMART
WD40 43 88 1.85e0 SMART
WD40 92 132 2.15e-4 SMART
WD40 135 175 6.19e-1 SMART
Pfam:Sec16_C 394 612 1.3e-7 PFAM
low complexity region 665 684 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 852 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165758
SMART Domains Protein: ENSMUSP00000130598
Gene: ENSMUSG00000051984

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. The protein has moderate similarity to rat VAP1 protein which is an endosomal membrane-associated protein, containing a putative Ca2+/calmodulin-dependent kinase II phosphorylation site. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T G 5: 8,936,873 F764C probably damaging Het
Aff1 A G 5: 103,834,212 D739G possibly damaging Het
Atp1a3 T C 7: 24,978,555 Y1012C probably damaging Het
Btbd10 T C 7: 113,329,926 T206A probably benign Het
Capn8 G T 1: 182,628,634 A650S possibly damaging Het
Catsper1 A C 19: 5,336,042 N101T probably damaging Het
Cdh23 A C 10: 60,324,976 S2070R probably benign Het
Cep350 A G 1: 155,861,772 V2775A probably benign Het
Clybl G A 14: 122,181,782 probably null Het
Cog4 T A 8: 110,852,372 N148K probably benign Het
Dbnl G A 11: 5,791,839 G44D possibly damaging Het
Dgcr2 A T 16: 17,849,766 N276K possibly damaging Het
Dnah9 T A 11: 65,855,234 T4018S possibly damaging Het
Dock3 A G 9: 106,897,340 L72P probably benign Het
Fabp4 T C 3: 10,206,045 T51A probably benign Het
Fam214b A G 4: 43,034,531 S355P probably damaging Het
Fars2 T A 13: 36,246,426 I279N probably damaging Het
Fas A T 19: 34,318,649 Q164L probably benign Het
Focad A G 4: 88,154,668 K107E probably damaging Het
Gga3 G A 11: 115,588,479 S338L probably benign Het
Grip1 A G 10: 119,930,035 R91G probably damaging Het
Igkv3-7 A G 6: 70,607,958 D94G possibly damaging Het
Kank3 G C 17: 33,817,653 R165P probably damaging Het
Kmt2d A T 15: 98,864,167 L434Q unknown Het
Krt18 A G 15: 102,029,830 T163A possibly damaging Het
Lrrc37a G T 11: 103,503,969 P210Q probably benign Het
Lyst T A 13: 13,677,963 S2183T probably benign Het
Myh9 G A 15: 77,776,937 A818V possibly damaging Het
Olfr344 T C 2: 36,568,691 I31T probably benign Het
Olfr906 A T 9: 38,488,301 I91F probably benign Het
Olfr98 G T 17: 37,262,916 Y249* probably null Het
Pde7b A G 10: 20,438,723 probably null Het
Pik3cb A T 9: 99,054,064 Y772N possibly damaging Het
Ppl C G 16: 5,088,990 R1147P probably damaging Het
Prl3d2 A T 13: 27,123,943 D69V probably benign Het
Psd3 A G 8: 67,719,944 F871L probably damaging Het
Rlf G A 4: 121,188,235 P152S probably benign Het
Rpa1 T C 11: 75,313,341 E270G possibly damaging Het
Scfd2 T C 5: 74,530,995 T209A probably benign Het
Scn11a A G 9: 119,792,344 L669P probably damaging Het
Serpina3k G T 12: 104,343,033 M245I probably benign Het
Slc9a3 T A 13: 74,157,704 I280N probably damaging Het
Soat1 A G 1: 156,434,202 V412A probably damaging Het
Spata31d1a A T 13: 59,702,782 S511T possibly damaging Het
Sphkap A T 1: 83,275,663 V1455E possibly damaging Het
Spns1 G A 7: 126,372,421 S319F possibly damaging Het
Tbxas1 G T 6: 39,071,430 M403I Het
Tln2 A T 9: 67,250,584 C1158S probably damaging Het
Tnrc18 T C 5: 142,793,056 T98A possibly damaging Het
Ttc23 T C 7: 67,669,746 L118P probably damaging Het
Tyr T A 7: 87,438,015 I430L probably damaging Het
Uck2 A G 1: 167,243,146 F5L probably benign Het
Ush2a G A 1: 188,753,650 V2986I probably benign Het
Vmn2r96 A G 17: 18,582,626 D266G probably benign Het
Wdr34 T C 2: 30,038,362 D84G probably benign Het
Yrdc A G 4: 124,853,884 D213G probably benign Het
Zfp612 C A 8: 110,088,971 T270K probably damaging Het
Other mutations in Sec31b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Sec31b APN 19 44527041 missense probably damaging 1.00
IGL01308:Sec31b APN 19 44523683 missense probably benign 0.02
IGL02404:Sec31b APN 19 44534788 missense probably damaging 0.99
IGL02663:Sec31b APN 19 44534278 missense probably damaging 1.00
IGL02728:Sec31b APN 19 44523115 missense probably damaging 0.96
IGL02830:Sec31b APN 19 44531703 missense probably damaging 1.00
IGL03141:Sec31b APN 19 44526320 splice site probably benign
IGL03247:Sec31b APN 19 44518940 missense possibly damaging 0.62
R0049:Sec31b UTSW 19 44520408 splice site probably benign
R0137:Sec31b UTSW 19 44534382 missense probably damaging 1.00
R0238:Sec31b UTSW 19 44525469 unclassified probably benign
R0239:Sec31b UTSW 19 44525469 unclassified probably benign
R0468:Sec31b UTSW 19 44518508 splice site probably benign
R0504:Sec31b UTSW 19 44534786 missense probably damaging 1.00
R0565:Sec31b UTSW 19 44524553 missense probably damaging 1.00
R0627:Sec31b UTSW 19 44525607 missense probably benign
R0749:Sec31b UTSW 19 44524506 missense probably damaging 0.96
R0815:Sec31b UTSW 19 44518173 nonsense probably null
R1162:Sec31b UTSW 19 44517648 nonsense probably null
R1398:Sec31b UTSW 19 44523665 missense probably benign 0.04
R1436:Sec31b UTSW 19 44536195 missense probably damaging 0.99
R1538:Sec31b UTSW 19 44518586 missense probably benign 0.42
R1599:Sec31b UTSW 19 44523153 missense possibly damaging 0.92
R2044:Sec31b UTSW 19 44536156 missense probably benign 0.07
R2135:Sec31b UTSW 19 44534696 missense probably damaging 0.99
R2167:Sec31b UTSW 19 44543353 missense possibly damaging 0.89
R2211:Sec31b UTSW 19 44523150 missense probably damaging 1.00
R2938:Sec31b UTSW 19 44536179 missense probably damaging 0.99
R3113:Sec31b UTSW 19 44518185 nonsense probably null
R4110:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4111:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4113:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4158:Sec31b UTSW 19 44525186 missense probably benign 0.34
R4226:Sec31b UTSW 19 44531710 missense probably benign
R4646:Sec31b UTSW 19 44526621 missense probably benign 0.00
R4732:Sec31b UTSW 19 44532677 missense probably damaging 1.00
R4733:Sec31b UTSW 19 44532677 missense probably damaging 1.00
R4795:Sec31b UTSW 19 44531746 missense probably benign 0.00
R4877:Sec31b UTSW 19 44535733 missense probably damaging 1.00
R5150:Sec31b UTSW 19 44520531 missense probably benign 0.08
R5377:Sec31b UTSW 19 44518637 missense probably damaging 1.00
R5381:Sec31b UTSW 19 44534371 missense probably damaging 1.00
R5708:Sec31b UTSW 19 44523144 missense probably damaging 1.00
R6002:Sec31b UTSW 19 44535764 missense probably benign 0.04
R6185:Sec31b UTSW 19 44543284 missense possibly damaging 0.77
R6675:Sec31b UTSW 19 44523775 missense probably benign
R6946:Sec31b UTSW 19 44534316 missense probably damaging 1.00
R7139:Sec31b UTSW 19 44518936 missense probably benign 0.00
R7237:Sec31b UTSW 19 44517708 missense probably damaging 1.00
R7270:Sec31b UTSW 19 44523043 missense probably benign 0.00
R7340:Sec31b UTSW 19 44528722 missense probably benign 0.00
R7505:Sec31b UTSW 19 44543707 missense probably damaging 1.00
R7584:Sec31b UTSW 19 44543323 missense probably damaging 0.99
R7584:Sec31b UTSW 19 44531556 splice site probably null
R7763:Sec31b UTSW 19 44523835 critical splice acceptor site probably null
R7777:Sec31b UTSW 19 44523773 nonsense probably null
R7900:Sec31b UTSW 19 44526230 missense probably damaging 1.00
R7952:Sec31b UTSW 19 44520540 missense probably benign 0.01
R8057:Sec31b UTSW 19 44519365 missense probably damaging 1.00
R8197:Sec31b UTSW 19 44524516 missense probably benign 0.25
R8739:Sec31b UTSW 19 44519181 missense probably benign 0.16
R8822:Sec31b UTSW 19 44519263 missense probably benign 0.02
R8916:Sec31b UTSW 19 44532344 missense
RF023:Sec31b UTSW 19 44535787 missense probably damaging 1.00
Z1177:Sec31b UTSW 19 44517314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGGGCAACTTCATGGAG -3'
(R):5'- TCATTTACAGGAGCAGGGCAC -3'

Sequencing Primer
(F):5'- GCAACTTCATGGAGCCCAG -3'
(R):5'- GGAGAGAGCCACCATTCAGTC -3'
Posted On2021-07-15