Incidental Mutation 'R8838:Olfr1054'
ID674258
Institutional Source Beutler Lab
Gene Symbol Olfr1054
Ensembl Gene ENSMUSG00000075190
Gene Nameolfactory receptor 1054
SynonymsGA_x6K02T2Q125-47811880-47810942, MOR188-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R8838 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86332135-86335433 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86332973 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 128 (K128E)
Ref Sequence ENSEMBL: ENSMUSP00000150810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099895] [ENSMUST00000213205]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099895
AA Change: K128E

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097480
Gene: ENSMUSG00000075190
AA Change: K128E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.8e-49 PFAM
Pfam:7tm_1 41 289 5.5e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213205
AA Change: K128E

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T A 11: 110,030,055 I1498F probably damaging Het
Aco2 T A 15: 81,911,927 N508K probably damaging Het
Aff4 T C 11: 53,406,638 S896P possibly damaging Het
Anapc2 T G 2: 25,273,534 V261G probably benign Het
Atm A G 9: 53,516,551 S420P probably damaging Het
Bag6 C T 17: 35,144,391 R736C probably damaging Het
Brca2 A G 5: 150,541,540 T1590A possibly damaging Het
Cacna2d3 C T 14: 28,969,263 C35Y probably benign Het
Cep170b G A 12: 112,743,725 R1433H probably damaging Het
Cmtm2a A G 8: 104,281,404 C138R probably damaging Het
Cntnap5c T A 17: 57,891,969 V86E Het
Cog7 A G 7: 121,949,883 I385T probably damaging Het
Col28a1 A T 6: 8,091,839 probably null Het
Dkk3 T C 7: 112,118,335 E309G probably benign Het
Dnah10 T C 5: 124,765,550 V1411A probably benign Het
Enox1 G T 14: 77,582,510 R235L probably benign Het
Foxn1 T C 11: 78,361,612 N317D possibly damaging Het
Hmmr T C 11: 40,714,027 T406A probably benign Het
Hpcal1 G A 12: 17,786,196 R9H probably benign Het
Iglv3 A T 16: 19,241,382 Y65* probably null Het
Itgal A G 7: 127,311,261 Y514C probably damaging Het
Kcnk9 T C 15: 72,546,170 E37G possibly damaging Het
Klhl40 A G 9: 121,780,041 D424G probably benign Het
Lbr A G 1: 181,820,729 L389P possibly damaging Het
Ly9 A G 1: 171,594,001 Y561H probably damaging Het
Mcoln3 T C 3: 146,139,371 F441L probably damaging Het
Muc20 G T 16: 32,793,459 T516K possibly damaging Het
Naa35 T C 13: 59,627,961 M551T probably benign Het
Nkx6-2 T A 7: 139,581,952 T170S probably damaging Het
Nlrp4c T A 7: 6,066,338 F413I Het
Olfr1490 G A 19: 13,655,007 V193M probably damaging Het
Olfr1496 C A 19: 13,781,017 T133K probably benign Het
Olfr786 T G 10: 129,437,196 L128R probably damaging Het
Pcdhga10 C T 18: 37,748,899 T571I possibly damaging Het
Pla2g4a A T 1: 149,871,505 M310K probably benign Het
Plaa T C 4: 94,583,554 T353A probably benign Het
Rapgef1 T C 2: 29,737,446 F1172S possibly damaging Het
Rfx2 T C 17: 56,780,877 T505A possibly damaging Het
Rfx4 T C 10: 84,840,894 V216A probably damaging Het
Rps6kb2 G T 19: 4,161,184 A114D probably damaging Het
Sdc2 T A 15: 33,023,751 L92* probably null Het
Slc18b1 A G 10: 23,820,866 Y319C probably benign Het
Slc22a15 A T 3: 101,883,533 Y219N probably damaging Het
Tfap2d T C 1: 19,104,812 L163P possibly damaging Het
Trank1 A G 9: 111,364,905 I666V probably benign Het
Trav14-1 G T 14: 53,554,552 A120S probably damaging Het
Trps1 T A 15: 50,889,611 N20I probably benign Het
Txndc16 A G 14: 45,140,571 Y682H probably damaging Het
Ube4a A T 9: 44,925,963 D991E probably damaging Het
Zswim4 C T 8: 84,214,070 R800Q probably damaging Het
Other mutations in Olfr1054
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Olfr1054 APN 2 86332704 nonsense probably null
IGL02266:Olfr1054 APN 2 86332979 missense probably damaging 0.98
IGL02398:Olfr1054 APN 2 86332524 nonsense probably null
IGL02535:Olfr1054 APN 2 86332675 missense probably damaging 1.00
IGL02590:Olfr1054 APN 2 86333000 missense possibly damaging 0.52
IGL02630:Olfr1054 APN 2 86332868 missense probably benign 0.39
PIT4151001:Olfr1054 UTSW 2 86332829 missense possibly damaging 0.60
R0520:Olfr1054 UTSW 2 86333131 missense probably damaging 1.00
R1079:Olfr1054 UTSW 2 86332841 missense probably damaging 0.96
R1887:Olfr1054 UTSW 2 86333273 missense possibly damaging 0.90
R2037:Olfr1054 UTSW 2 86332430 missense probably benign 0.03
R2120:Olfr1054 UTSW 2 86333345 missense probably benign 0.00
R2153:Olfr1054 UTSW 2 86332528 missense probably damaging 1.00
R4523:Olfr1054 UTSW 2 86333300 missense probably benign 0.12
R4836:Olfr1054 UTSW 2 86333227 missense probably benign 0.12
R6147:Olfr1054 UTSW 2 86332500 missense probably damaging 1.00
R6802:Olfr1054 UTSW 2 86333185 missense possibly damaging 0.91
R6886:Olfr1054 UTSW 2 86333064 nonsense probably null
R6894:Olfr1054 UTSW 2 86332951 missense probably damaging 1.00
R7275:Olfr1054 UTSW 2 86332792 missense possibly damaging 0.91
R7322:Olfr1054 UTSW 2 86332564 missense probably benign 0.14
R7325:Olfr1054 UTSW 2 86333000 missense possibly damaging 0.52
R7526:Olfr1054 UTSW 2 86333353 start codon destroyed probably null 1.00
R7976:Olfr1054 UTSW 2 86332720 missense probably benign 0.05
R8421:Olfr1054 UTSW 2 86332903 missense possibly damaging 0.80
Z1176:Olfr1054 UTSW 2 86332706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATATTAAAGGGAGACTATCGCAG -3'
(R):5'- GGACTCCCGATTGCAAACAC -3'

Sequencing Primer
(F):5'- TATCGCAGAAATGACTAACGATCCTG -3'
(R):5'- AGACATCTGGCTATCACTGATCTTGG -3'
Posted On2021-07-15