Incidental Mutation 'R8838:Aff4'
ID 674280
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene Name AF4/FMR2 family, member 4
Synonyms Laf4l, Alf4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8838 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 53350833-53421830 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53406638 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 896 (S896P)
Ref Sequence ENSEMBL: ENSMUSP00000051479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945]
AlphaFold Q9ESC8
Predicted Effect possibly damaging
Transcript: ENSMUST00000060945
AA Change: S896P

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: S896P

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Meta Mutation Damage Score 0.0635 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T A 11: 110,030,055 I1498F probably damaging Het
Aco2 T A 15: 81,911,927 N508K probably damaging Het
Anapc2 T G 2: 25,273,534 V261G probably benign Het
Atm A G 9: 53,516,551 S420P probably damaging Het
Bag6 C T 17: 35,144,391 R736C probably damaging Het
Brca2 A G 5: 150,541,540 T1590A possibly damaging Het
Cacna2d3 C T 14: 28,969,263 C35Y probably benign Het
Cep170b G A 12: 112,743,725 R1433H probably damaging Het
Cmtm2a A G 8: 104,281,404 C138R probably damaging Het
Cntnap5c T A 17: 57,891,969 V86E Het
Cog7 A G 7: 121,949,883 I385T probably damaging Het
Col28a1 A T 6: 8,091,839 probably null Het
Dkk3 T C 7: 112,118,335 E309G probably benign Het
Dnah10 T C 5: 124,765,550 V1411A probably benign Het
Enox1 G T 14: 77,582,510 R235L probably benign Het
Foxn1 T C 11: 78,361,612 N317D possibly damaging Het
Grip2 G A 6: 91,785,740 probably benign Het
Hmmr T C 11: 40,714,027 T406A probably benign Het
Hpcal1 G A 12: 17,786,196 R9H probably benign Het
Iglv3 A T 16: 19,241,382 Y65* probably null Het
Itgal A G 7: 127,311,261 Y514C probably damaging Het
Kcnk9 T C 15: 72,546,170 E37G possibly damaging Het
Klhl40 A G 9: 121,780,041 D424G probably benign Het
Lbr A G 1: 181,820,729 L389P possibly damaging Het
Ly9 A G 1: 171,594,001 Y561H probably damaging Het
Mcoln3 T C 3: 146,139,371 F441L probably damaging Het
Muc20 G T 16: 32,793,459 T516K possibly damaging Het
Naa35 T C 13: 59,627,961 M551T probably benign Het
Nkx6-2 T A 7: 139,581,952 T170S probably damaging Het
Nlrp4c T A 7: 6,066,338 F413I Het
Olfr1054 T C 2: 86,332,973 K128E possibly damaging Het
Olfr1490 G A 19: 13,655,007 V193M probably damaging Het
Olfr1496 C A 19: 13,781,017 T133K probably benign Het
Olfr786 T G 10: 129,437,196 L128R probably damaging Het
Pcdhga10 C T 18: 37,748,899 T571I possibly damaging Het
Pla2g4a A T 1: 149,871,505 M310K probably benign Het
Plaa T C 4: 94,583,554 T353A probably benign Het
Rapgef1 T C 2: 29,737,446 F1172S possibly damaging Het
Rfx2 T C 17: 56,780,877 T505A possibly damaging Het
Rfx4 T C 10: 84,840,894 V216A probably damaging Het
Rps6kb2 G T 19: 4,161,184 A114D probably damaging Het
Sdc2 T A 15: 33,023,751 L92* probably null Het
Slc18b1 A G 10: 23,820,866 Y319C probably benign Het
Slc22a15 A T 3: 101,883,533 Y219N probably damaging Het
Tarbp1 A T 8: 126,450,830 probably benign Het
Tfap2d T C 1: 19,104,812 L163P possibly damaging Het
Trank1 A G 9: 111,364,905 I666V probably benign Het
Trav14-1 G T 14: 53,554,552 A120S probably damaging Het
Trps1 T A 15: 50,889,611 N20I probably benign Het
Txndc16 A G 14: 45,140,571 Y682H probably damaging Het
Ube4a A T 9: 44,925,963 D991E probably damaging Het
Zswim4 C T 8: 84,214,070 R800Q probably damaging Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53411990 missense probably damaging 0.98
IGL01348:Aff4 APN 11 53402500 missense probably benign
IGL01446:Aff4 APN 11 53415469 missense probably damaging 0.99
IGL02151:Aff4 APN 11 53399806 missense probably benign
IGL02526:Aff4 APN 11 53406682 splice site probably benign
IGL02567:Aff4 APN 11 53372751 missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53409371 splice site probably benign
IGL02707:Aff4 APN 11 53399740 missense probably benign
R0090:Aff4 UTSW 11 53392782 missense probably benign 0.01
R0128:Aff4 UTSW 11 53415466 missense probably damaging 0.99
R0243:Aff4 UTSW 11 53397858 missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53372881 missense probably benign 0.00
R0347:Aff4 UTSW 11 53400088 missense probably benign 0.01
R0732:Aff4 UTSW 11 53375596 missense probably benign
R0737:Aff4 UTSW 11 53410953 nonsense probably null
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1500:Aff4 UTSW 11 53372378 missense probably benign 0.00
R1693:Aff4 UTSW 11 53396553 missense probably damaging 1.00
R1743:Aff4 UTSW 11 53368695 missense possibly damaging 0.65
R1961:Aff4 UTSW 11 53372999 missense probably damaging 1.00
R2048:Aff4 UTSW 11 53398385 missense probably benign 0.39
R2138:Aff4 UTSW 11 53372512 missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53399619 missense probably damaging 1.00
R2379:Aff4 UTSW 11 53408478 splice site probably benign
R4156:Aff4 UTSW 11 53410899 intron probably benign
R5001:Aff4 UTSW 11 53404357 missense probably damaging 1.00
R5281:Aff4 UTSW 11 53372288 missense probably damaging 1.00
R5477:Aff4 UTSW 11 53408472 critical splice donor site probably null
R5677:Aff4 UTSW 11 53400275 missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53373010 missense probably damaging 0.99
R6576:Aff4 UTSW 11 53400441 missense probably damaging 1.00
R6764:Aff4 UTSW 11 53399830 missense probably damaging 1.00
R6988:Aff4 UTSW 11 53398237 missense probably damaging 1.00
R7034:Aff4 UTSW 11 53408409 missense probably damaging 0.99
R7177:Aff4 UTSW 11 53406639 missense probably benign 0.10
R7426:Aff4 UTSW 11 53372875 missense probably damaging 1.00
R7755:Aff4 UTSW 11 53398379 missense probably damaging 0.97
R7848:Aff4 UTSW 11 53404512 missense probably benign 0.05
R7968:Aff4 UTSW 11 53409348 missense probably damaging 1.00
R8159:Aff4 UTSW 11 53411894 missense possibly damaging 0.71
R8218:Aff4 UTSW 11 53398257 missense probably damaging 0.98
R8241:Aff4 UTSW 11 53400171 missense probably benign 0.00
R8284:Aff4 UTSW 11 53404552 missense probably damaging 0.99
R8373:Aff4 UTSW 11 53400267 nonsense probably null
R8695:Aff4 UTSW 11 53368682 missense probably damaging 1.00
R8777:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8777-TAIL:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8780:Aff4 UTSW 11 53380617 missense probably damaging 1.00
R8798:Aff4 UTSW 11 53400508 critical splice donor site probably benign
R8939:Aff4 UTSW 11 53372404 missense probably benign
R9146:Aff4 UTSW 11 53408136 missense probably benign 0.06
R9329:Aff4 UTSW 11 53397859 missense probably damaging 1.00
R9378:Aff4 UTSW 11 53372479 missense probably damaging 0.98
R9471:Aff4 UTSW 11 53380646 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACACTCAGTTCGTATCTTCAGTTCG -3'
(R):5'- GTCACTGGTTGTTAAAAGAGTAGC -3'

Sequencing Primer
(F):5'- AAGTACCTACCCTAAGTGCCTTG -3'
(R):5'- CATGCCTTTAATCCAGACACTG -3'
Posted On 2021-07-15