Incidental Mutation 'R8838:Foxn1'
ID674281
Institutional Source Beutler Lab
Gene Symbol Foxn1
Ensembl Gene ENSMUSG00000002057
Gene Nameforkhead box N1
Synonymswhn, D11Bhm185e, Hfh11
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8838 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location78357577-78386558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78361612 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 317 (N317D)
Ref Sequence ENSEMBL: ENSMUSP00000103929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108294]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108294
AA Change: N317D

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103929
Gene: ENSMUSG00000002057
AA Change: N317D

DomainStartEndE-ValueType
FH 269 361 2.43e-45 SMART
low complexity region 392 409 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 558 586 N/A INTRINSIC
low complexity region 593 609 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the forkhead family or "winged-helix" transcription factors that are important in developmental processes, immune system regulation, metabolism, cancer and aging. This gene family has over 100 members, subdivided into classes (A-Q) based on phylogeny. The encoded protein is proposed to regulate development of the thymus and differentiation of keratinocytes. Mutations in this gene cause severe primary T-cell immunodeficiency and congenital alopecia. In mouse mutations of this gene underlie the phenotype of the nude mouse, which has been widely used as a model system in oncology, immunology, dermatology, and transplantation studies. In humans mutations in this gene have been correlated with T-cell immunodeficiency, the skin disorder congenital alopecia, and nail dystrophy. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygotes for different mutations have in genetically determined absence or loss of hair and failed hair keratinization, premature lethality (differing by genetic background) and absence of thymus, resulting in multiple immune abnormalities. Heterozygotes have enlarged thymuses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T A 11: 110,030,055 I1498F probably damaging Het
Aco2 T A 15: 81,911,927 N508K probably damaging Het
Aff4 T C 11: 53,406,638 S896P possibly damaging Het
Anapc2 T G 2: 25,273,534 V261G probably benign Het
Atm A G 9: 53,516,551 S420P probably damaging Het
Bag6 C T 17: 35,144,391 R736C probably damaging Het
Brca2 A G 5: 150,541,540 T1590A possibly damaging Het
Cacna2d3 C T 14: 28,969,263 C35Y probably benign Het
Cep170b G A 12: 112,743,725 R1433H probably damaging Het
Cmtm2a A G 8: 104,281,404 C138R probably damaging Het
Cntnap5c T A 17: 57,891,969 V86E Het
Cog7 A G 7: 121,949,883 I385T probably damaging Het
Col28a1 A T 6: 8,091,839 probably null Het
Dkk3 T C 7: 112,118,335 E309G probably benign Het
Dnah10 T C 5: 124,765,550 V1411A probably benign Het
Enox1 G T 14: 77,582,510 R235L probably benign Het
Hmmr T C 11: 40,714,027 T406A probably benign Het
Hpcal1 G A 12: 17,786,196 R9H probably benign Het
Iglv3 A T 16: 19,241,382 Y65* probably null Het
Itgal A G 7: 127,311,261 Y514C probably damaging Het
Kcnk9 T C 15: 72,546,170 E37G possibly damaging Het
Klhl40 A G 9: 121,780,041 D424G probably benign Het
Lbr A G 1: 181,820,729 L389P possibly damaging Het
Ly9 A G 1: 171,594,001 Y561H probably damaging Het
Mcoln3 T C 3: 146,139,371 F441L probably damaging Het
Muc20 G T 16: 32,793,459 T516K possibly damaging Het
Naa35 T C 13: 59,627,961 M551T probably benign Het
Nkx6-2 T A 7: 139,581,952 T170S probably damaging Het
Nlrp4c T A 7: 6,066,338 F413I Het
Olfr1054 T C 2: 86,332,973 K128E possibly damaging Het
Olfr1490 G A 19: 13,655,007 V193M probably damaging Het
Olfr1496 C A 19: 13,781,017 T133K probably benign Het
Olfr786 T G 10: 129,437,196 L128R probably damaging Het
Pcdhga10 C T 18: 37,748,899 T571I possibly damaging Het
Pla2g4a A T 1: 149,871,505 M310K probably benign Het
Plaa T C 4: 94,583,554 T353A probably benign Het
Rapgef1 T C 2: 29,737,446 F1172S possibly damaging Het
Rfx2 T C 17: 56,780,877 T505A possibly damaging Het
Rfx4 T C 10: 84,840,894 V216A probably damaging Het
Rps6kb2 G T 19: 4,161,184 A114D probably damaging Het
Sdc2 T A 15: 33,023,751 L92* probably null Het
Slc18b1 A G 10: 23,820,866 Y319C probably benign Het
Slc22a15 A T 3: 101,883,533 Y219N probably damaging Het
Tfap2d T C 1: 19,104,812 L163P possibly damaging Het
Trank1 A G 9: 111,364,905 I666V probably benign Het
Trav14-1 G T 14: 53,554,552 A120S probably damaging Het
Trps1 T A 15: 50,889,611 N20I probably benign Het
Txndc16 A G 14: 45,140,571 Y682H probably damaging Het
Ube4a A T 9: 44,925,963 D991E probably damaging Het
Zswim4 C T 8: 84,214,070 R800Q probably damaging Het
Other mutations in Foxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Foxn1 APN 11 78371283 missense probably benign 0.24
IGL01391:Foxn1 APN 11 78361494 missense probably damaging 1.00
IGL01737:Foxn1 APN 11 78360906 missense possibly damaging 0.81
IGL02669:Foxn1 APN 11 78371160 missense probably damaging 0.99
IGL03276:Foxn1 APN 11 78371124 missense probably benign 0.16
R0200:Foxn1 UTSW 11 78361040 missense probably damaging 1.00
R0639:Foxn1 UTSW 11 78371144 missense possibly damaging 0.67
R0739:Foxn1 UTSW 11 78358999 missense probably benign 0.01
R1112:Foxn1 UTSW 11 78371030 missense probably benign 0.29
R1167:Foxn1 UTSW 11 78359066 missense probably damaging 0.99
R1251:Foxn1 UTSW 11 78358785 missense probably damaging 0.99
R1474:Foxn1 UTSW 11 78361107 missense probably benign
R1506:Foxn1 UTSW 11 78365935 splice site probably benign
R1616:Foxn1 UTSW 11 78358866 missense probably benign 0.00
R1795:Foxn1 UTSW 11 78371225 missense probably benign 0.01
R1905:Foxn1 UTSW 11 78371810 splice site probably null
R1906:Foxn1 UTSW 11 78371810 splice site probably null
R1975:Foxn1 UTSW 11 78365937 splice site probably benign
R1976:Foxn1 UTSW 11 78365937 splice site probably benign
R2206:Foxn1 UTSW 11 78358804 missense probably benign 0.02
R2207:Foxn1 UTSW 11 78358804 missense probably benign 0.02
R2988:Foxn1 UTSW 11 78358777 missense possibly damaging 0.74
R2989:Foxn1 UTSW 11 78358777 missense possibly damaging 0.74
R5015:Foxn1 UTSW 11 78371163 missense probably damaging 1.00
R5140:Foxn1 UTSW 11 78361633 missense probably benign 0.18
R5533:Foxn1 UTSW 11 78365966 missense probably damaging 1.00
R6712:Foxn1 UTSW 11 78361259 missense probably damaging 1.00
R6852:Foxn1 UTSW 11 78360960 missense probably benign 0.00
R7176:Foxn1 UTSW 11 78360867 missense possibly damaging 0.94
R7331:Foxn1 UTSW 11 78358789 missense probably damaging 1.00
R7515:Foxn1 UTSW 11 78371144 missense possibly damaging 0.67
R7562:Foxn1 UTSW 11 78371132 missense probably damaging 1.00
R7657:Foxn1 UTSW 11 78365964 missense probably benign 0.29
X0067:Foxn1 UTSW 11 78361542 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAGCCTCACCTGGTTTG -3'
(R):5'- CTTAGGATCAACGATTCTGCCC -3'

Sequencing Primer
(F):5'- GGTTTGGCCATGCTTTTGC -3'
(R):5'- CACTAAAGGGTTCTACGAATGC -3'
Posted On2021-07-15