Incidental Mutation 'R8838:Cacna2d3'
ID 674286
Institutional Source Beutler Lab
Gene Symbol Cacna2d3
Ensembl Gene ENSMUSG00000021991
Gene Name calcium channel, voltage-dependent, alpha2/delta subunit 3
Synonyms alpha2delta3, alpha 2 delta-3
MMRRC Submission 068666-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8838 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 28904943-29721864 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 28969263 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 35 (C35Y)
Ref Sequence ENSEMBL: ENSMUSP00000152967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022567] [ENSMUST00000225668] [ENSMUST00000225985]
AlphaFold Q9Z1L5
Predicted Effect probably benign
Transcript: ENSMUST00000022567
SMART Domains Protein: ENSMUSP00000022567
Gene: ENSMUSG00000021991

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Blast:WNT1 28 103 2e-33 BLAST
Pfam:VWA_N 113 229 6.8e-40 PFAM
VWA 254 439 4.13e-24 SMART
Pfam:Cache_1 452 548 3e-32 PFAM
low complexity region 1070 1088 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000225668
AA Change: C35Y

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000225985
AA Change: C35Y

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased startle reflex and occasional animals show increased aggression and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T A 11: 110,030,055 I1498F probably damaging Het
Aco2 T A 15: 81,911,927 N508K probably damaging Het
Aff4 T C 11: 53,406,638 S896P possibly damaging Het
Anapc2 T G 2: 25,273,534 V261G probably benign Het
Atm A G 9: 53,516,551 S420P probably damaging Het
Bag6 C T 17: 35,144,391 R736C probably damaging Het
Brca2 A G 5: 150,541,540 T1590A possibly damaging Het
Cep170b G A 12: 112,743,725 R1433H probably damaging Het
Cmtm2a A G 8: 104,281,404 C138R probably damaging Het
Cntnap5c T A 17: 57,891,969 V86E Het
Cog7 A G 7: 121,949,883 I385T probably damaging Het
Col28a1 A T 6: 8,091,839 probably null Het
Dkk3 T C 7: 112,118,335 E309G probably benign Het
Dnah10 T C 5: 124,765,550 V1411A probably benign Het
Enox1 G T 14: 77,582,510 R235L probably benign Het
Foxn1 T C 11: 78,361,612 N317D possibly damaging Het
Grip2 G A 6: 91,785,740 probably benign Het
Hmmr T C 11: 40,714,027 T406A probably benign Het
Hpcal1 G A 12: 17,786,196 R9H probably benign Het
Iglv3 A T 16: 19,241,382 Y65* probably null Het
Itgal A G 7: 127,311,261 Y514C probably damaging Het
Kcnk9 T C 15: 72,546,170 E37G possibly damaging Het
Klhl40 A G 9: 121,780,041 D424G probably benign Het
Lbr A G 1: 181,820,729 L389P possibly damaging Het
Ly9 A G 1: 171,594,001 Y561H probably damaging Het
Mcoln3 T C 3: 146,139,371 F441L probably damaging Het
Muc20 G T 16: 32,793,459 T516K possibly damaging Het
Naa35 T C 13: 59,627,961 M551T probably benign Het
Nkx6-2 T A 7: 139,581,952 T170S probably damaging Het
Nlrp4c T A 7: 6,066,338 F413I Het
Olfr1054 T C 2: 86,332,973 K128E possibly damaging Het
Olfr1490 G A 19: 13,655,007 V193M probably damaging Het
Olfr1496 C A 19: 13,781,017 T133K probably benign Het
Olfr786 T G 10: 129,437,196 L128R probably damaging Het
Pcdhga10 C T 18: 37,748,899 T571I possibly damaging Het
Pla2g4a A T 1: 149,871,505 M310K probably benign Het
Plaa T C 4: 94,583,554 T353A probably benign Het
Rapgef1 T C 2: 29,737,446 F1172S possibly damaging Het
Rfx2 T C 17: 56,780,877 T505A possibly damaging Het
Rfx4 T C 10: 84,840,894 V216A probably damaging Het
Rps6kb2 G T 19: 4,161,184 A114D probably damaging Het
Sdc2 T A 15: 33,023,751 L92* probably null Het
Slc18b1 A G 10: 23,820,866 Y319C probably benign Het
Slc22a15 A T 3: 101,883,533 Y219N probably damaging Het
Tarbp1 A T 8: 126,450,830 probably benign Het
Tfap2d T C 1: 19,104,812 L163P possibly damaging Het
Trank1 A G 9: 111,364,905 I666V probably benign Het
Trav14-1 G T 14: 53,554,552 A120S probably damaging Het
Trps1 T A 15: 50,889,611 N20I probably benign Het
Txndc16 A G 14: 45,140,571 Y682H probably damaging Het
Ube4a A T 9: 44,925,963 D991E probably damaging Het
Zswim4 C T 8: 84,214,070 R800Q probably damaging Het
Other mutations in Cacna2d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cacna2d3 APN 14 29300731 splice site probably benign
IGL01150:Cacna2d3 APN 14 29183641 missense possibly damaging 0.95
IGL01390:Cacna2d3 APN 14 28943591 missense possibly damaging 0.91
IGL01626:Cacna2d3 APN 14 28943607 missense possibly damaging 0.90
IGL02127:Cacna2d3 APN 14 29063875 unclassified probably benign
IGL02237:Cacna2d3 APN 14 29346997 missense probably benign 0.09
IGL02274:Cacna2d3 APN 14 28956870 splice site probably null
IGL02604:Cacna2d3 APN 14 29293109 missense possibly damaging 0.61
IGL02806:Cacna2d3 APN 14 29351950 splice site probably null
IGL02838:Cacna2d3 APN 14 29300828 critical splice acceptor site probably null
IGL02894:Cacna2d3 APN 14 29064319 critical splice acceptor site probably null
IGL03061:Cacna2d3 APN 14 29058431 missense probably damaging 0.98
IGL03117:Cacna2d3 APN 14 29467952 missense probably damaging 1.00
IGL03265:Cacna2d3 APN 14 28952286 missense probably damaging 0.98
IGL03266:Cacna2d3 APN 14 29300748 missense probably benign 0.01
IGL03396:Cacna2d3 APN 14 29720877 nonsense probably null
R0094:Cacna2d3 UTSW 14 29170503 critical splice donor site probably null
R0326:Cacna2d3 UTSW 14 29045644 missense probably damaging 0.96
R0485:Cacna2d3 UTSW 14 29534519 missense possibly damaging 0.89
R0669:Cacna2d3 UTSW 14 29467949 missense probably benign 0.40
R0730:Cacna2d3 UTSW 14 28982365 missense probably benign 0.02
R0736:Cacna2d3 UTSW 14 29058628 missense probably benign 0.02
R1073:Cacna2d3 UTSW 14 29045623 missense probably damaging 0.99
R1116:Cacna2d3 UTSW 14 29064321 splice site probably benign
R1312:Cacna2d3 UTSW 14 29045668 missense probably benign 0.00
R1467:Cacna2d3 UTSW 14 29333779 missense possibly damaging 0.67
R1467:Cacna2d3 UTSW 14 29333779 missense possibly damaging 0.67
R1501:Cacna2d3 UTSW 14 28981180 missense probably damaging 1.00
R1525:Cacna2d3 UTSW 14 28972242 missense probably benign 0.01
R1574:Cacna2d3 UTSW 14 29351822 missense probably damaging 1.00
R1574:Cacna2d3 UTSW 14 29351822 missense probably damaging 1.00
R1866:Cacna2d3 UTSW 14 28969214 missense probably damaging 1.00
R2403:Cacna2d3 UTSW 14 28905302 missense probably benign 0.38
R2981:Cacna2d3 UTSW 14 29063918 missense probably damaging 1.00
R3715:Cacna2d3 UTSW 14 29346923 missense probably damaging 1.00
R3791:Cacna2d3 UTSW 14 29183581 missense probably benign 0.03
R3847:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R3849:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R3850:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R4558:Cacna2d3 UTSW 14 29103713 missense possibly damaging 0.70
R4594:Cacna2d3 UTSW 14 28982346 missense probably benign 0.13
R4681:Cacna2d3 UTSW 14 29293135 missense probably damaging 1.00
R4868:Cacna2d3 UTSW 14 28956786 splice site probably null
R4965:Cacna2d3 UTSW 14 28982332 missense probably benign 0.07
R5133:Cacna2d3 UTSW 14 29293178 missense possibly damaging 0.75
R5311:Cacna2d3 UTSW 14 29347030 missense probably damaging 0.99
R5432:Cacna2d3 UTSW 14 28943555 critical splice donor site probably null
R5873:Cacna2d3 UTSW 14 29720934 missense probably benign 0.31
R6103:Cacna2d3 UTSW 14 29396489 missense probably damaging 1.00
R6197:Cacna2d3 UTSW 14 28908321 missense probably benign 0.38
R6396:Cacna2d3 UTSW 14 29396565 missense probably benign 0.03
R6626:Cacna2d3 UTSW 14 29064186 unclassified probably benign
R6632:Cacna2d3 UTSW 14 28905265 makesense probably null
R6706:Cacna2d3 UTSW 14 29124685 critical splice acceptor site probably null
R6765:Cacna2d3 UTSW 14 29055977 missense probably damaging 1.00
R6945:Cacna2d3 UTSW 14 28969318 intron probably benign
R7009:Cacna2d3 UTSW 14 28969365 start codon destroyed probably null
R7069:Cacna2d3 UTSW 14 28969303 intron probably benign
R7146:Cacna2d3 UTSW 14 29721697 missense unknown
R7427:Cacna2d3 UTSW 14 29064275 missense probably damaging 1.00
R7428:Cacna2d3 UTSW 14 29064275 missense probably damaging 1.00
R7445:Cacna2d3 UTSW 14 29058618 missense possibly damaging 0.88
R7505:Cacna2d3 UTSW 14 29045544 splice site probably null
R7560:Cacna2d3 UTSW 14 29058421 missense probably benign 0.18
R7703:Cacna2d3 UTSW 14 29043546 missense possibly damaging 0.90
R8042:Cacna2d3 UTSW 14 29105038 splice site probably benign
R8096:Cacna2d3 UTSW 14 29103700 missense possibly damaging 0.62
R8280:Cacna2d3 UTSW 14 28982371 missense probably benign 0.25
R8814:Cacna2d3 UTSW 14 29097815 missense probably damaging 1.00
R8864:Cacna2d3 UTSW 14 29333778 missense probably damaging 1.00
R9103:Cacna2d3 UTSW 14 29347014 missense probably damaging 1.00
R9341:Cacna2d3 UTSW 14 28982358 missense possibly damaging 0.92
R9343:Cacna2d3 UTSW 14 28982358 missense possibly damaging 0.92
R9567:Cacna2d3 UTSW 14 28905311 missense probably benign 0.38
Z1088:Cacna2d3 UTSW 14 29064308 missense probably damaging 0.99
Z1177:Cacna2d3 UTSW 14 29347163 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CACAGAGTTCAACAAGTGGGATTG -3'
(R):5'- CTGCTGTGACTGTTTCAGCC -3'

Sequencing Primer
(F):5'- TCAACAAGTGGGATTGGCTCC -3'
(R):5'- GTGACTGTTTCAGCCATTCCCAG -3'
Posted On 2021-07-15