Mutagenetix > Incidental Mutation

Incidental Mutation 'R8839:Csmd2'

674308

Institutional Source

Beutler Lab

Gene Symbol

Csmd2

Ensembl Gene

ENSMUSG00000028804

Gene Name

CUB and Sushi multiple domains 2

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R8839 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

127987857-128567656 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 128442888 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 1420 (I1420L)

Ref Sequence

ENSEMBL: ENSMUSP00000138958 (fasta)

AlphaFold

no structure available at present

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (51/51)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	T	C	6: 48,931,040	Y325H	probably damaging	Het
Ace3	T	C	11: 105,998,368	Y475H	probably damaging	Het
Ankfy1	T	C	11: 72,730,566	I226T	probably benign	Het
Anln	G	A	9: 22,356,172	S825L	probably benign	Het
B3galt4	A	G	17: 33,950,893	S124P	possibly damaging	Het
Cabin1	T	C	10: 75,656,816	I1882V	probably benign	Het
Caprin2	A	T	6: 148,873,027	S262R	probably benign	Het
Cyp2b9	T	G	7: 26,200,760	V331G	probably damaging	Het
Cyp3a59	A	T	5: 146,109,086	M433L	probably benign	Het
Edrf1	A	G	7: 133,653,915	D597G	probably benign	Het
Emc3	G	A	6: 113,519,970	R147C	possibly damaging	Het
Fam172a	A	T	13: 77,999,662	H283L	probably benign	Het
Fkbp7	T	C	2: 76,667,237		probably benign	Het
Flii	T	C	11: 60,718,607	T665A	possibly damaging	Het
Fxr1	A	G	3: 34,046,682		probably benign	Het
Gpr37	T	G	6: 25,669,370	I492L	probably benign	Het
Hmg20b	A	C	10: 81,348,915	W108G	probably damaging	Het
Ighv9-3	G	A	12: 114,140,765	T93I	possibly damaging	Het
Inpp5a	T	C	7: 139,389,433	V15A	probably benign	Het
Inpp5d	T	A	1: 87,691,711	Y376N	probably damaging	Het
Ints6	A	G	14: 62,693,673	F854L	probably benign	Het
Ipo7	A	T	7: 110,042,016	K314N	probably damaging	Het
Ltn1	C	A	16: 87,418,502	C415F	probably damaging	Het
Mfsd9	T	C	1: 40,774,394	T254A	probably benign	Het
Musk	A	G	4: 58,286,151	T14A	probably benign	Het
Ncapd3	T	C	9: 27,094,434	V1438A		Het
Nnt	A	T	13: 119,357,637	V636D	unknown	Het
Olfr1338	A	G	4: 118,754,214	L110P	probably damaging	Het
Olfr629	A	G	7: 103,740,814	I142T	probably benign	Het
Olfr748	A	T	14: 50,710,500	T57S	possibly damaging	Het
Ost4	T	C	5: 30,907,591		probably benign	Het
Pdzph1	T	C	17: 58,950,242	T934A	probably benign	Het
Plekhn1	T	A	4: 156,222,589		probably benign	Het
Prkd1	T	C	12: 50,342,833		probably benign	Het
Ptch1	A	T	13: 63,541,224	L413Q	probably damaging	Het
S100pbp	A	G	4: 129,182,207		probably null	Het
Sec23a	T	C	12: 58,990,995	K361E	possibly damaging	Het
Sema3b	C	T	9: 107,601,353		probably benign	Het
Serpina3g	A	G	12: 104,237,779		probably benign	Het
Slc23a2	C	T	2: 132,101,472		silent	Het
Smug1	T	C	15: 103,155,820	R225G	possibly damaging	Het
Srbd1	T	A	17: 85,988,421	I854L	probably benign	Het
Tbc1d16	G	A	11: 119,156,648	R417C	probably damaging	Het
Tiam1	A	G	16: 89,884,939	Y384H	probably damaging	Het
Trappc9	T	A	15: 73,058,238	K90*	probably null	Het
Tubgcp6	A	T	15: 89,103,478	H1097Q	possibly damaging	Het
Ugt2b37	A	G	5: 87,254,556	L72P	probably damaging	Het
Vmn2r20	A	T	6: 123,396,556	H442Q	possibly damaging	Het
Vmn2r65	A	T	7: 84,946,281	Y398*	probably null	Het
Zfhx4	A	G	3: 5,401,855	T2383A	probably benign	Het

Other mutations in Csmd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Csmd2	APN	4	128483473	missense	probably benign	0.03
IGL01098:Csmd2	APN	4	128059052	missense	probably damaging	0.99
IGL01114:Csmd2	APN	4	128369130	missense	probably benign	0.04
IGL01364:Csmd2	APN	4	128414288	missense	probably benign	0.01
IGL01530:Csmd2	APN	4	128414301	missense	possibly damaging	0.66
IGL01582:Csmd2	APN	4	128563305	nonsense	probably null
IGL01670:Csmd2	APN	4	128513371	splice site	probably benign
IGL01707:Csmd2	APN	4	128383005	missense	possibly damaging	0.81
IGL01810:Csmd2	APN	4	128480845	splice site	probably benign
IGL01837:Csmd2	APN	4	128419570	missense	possibly damaging	0.92
IGL01924:Csmd2	APN	4	128559947	missense	unknown
IGL02013:Csmd2	APN	4	128321323	missense	possibly damaging	0.47
IGL02020:Csmd2	APN	4	128559879	missense	probably damaging	1.00
IGL02037:Csmd2	APN	4	128477470	splice site	probably benign
IGL02303:Csmd2	APN	4	128369008	missense	probably benign	0.01
IGL02317:Csmd2	APN	4	128463727	splice site	probably benign
IGL02322:Csmd2	APN	4	128463727	splice site	probably benign
IGL02338:Csmd2	APN	4	128395066	missense	possibly damaging	0.79
IGL02412:Csmd2	APN	4	128513372	splice site	probably benign
IGL02428:Csmd2	APN	4	128474816	missense	possibly damaging	0.82
IGL02491:Csmd2	APN	4	128534257	missense	probably benign
IGL02701:Csmd2	APN	4	128496141	missense	probably benign	0.17
IGL02801:Csmd2	APN	4	128552075	splice site	probably null
IGL02818:Csmd2	APN	4	128209728	missense	probably damaging	1.00
IGL02863:Csmd2	APN	4	128521884	missense	probably benign	0.00
IGL02876:Csmd2	APN	4	128321335	nonsense	probably null
IGL02977:Csmd2	APN	4	128493276	nonsense	probably null
IGL03006:Csmd2	APN	4	128480765	splice site	probably benign
IGL03032:Csmd2	APN	4	128519041	missense	probably benign	0.03
IGL03148:Csmd2	APN	4	128384269	missense	probably damaging	1.00
IGL03157:Csmd2	APN	4	128414299	nonsense	probably null
IGL03245:Csmd2	APN	4	128509122	missense	probably benign	0.12
IGL03376:Csmd2	APN	4	128517671	missense	probably benign	0.03
IGL03014:Csmd2	UTSW	4	128296429	missense	probably benign	0.01
R0109:Csmd2	UTSW	4	128544743	missense	probably benign	0.03
R0112:Csmd2	UTSW	4	128496029	missense	probably damaging	1.00
R0157:Csmd2	UTSW	4	128521911	missense	probably benign	0.02
R0390:Csmd2	UTSW	4	128133673	intron	probably benign
R0441:Csmd2	UTSW	4	128520230	missense	probably benign	0.00
R0519:Csmd2	UTSW	4	128487005	missense	possibly damaging	0.95
R0743:Csmd2	UTSW	4	128113676	missense	probably benign	0.00
R0746:Csmd2	UTSW	4	128414297	missense	probably damaging	1.00
R0973:Csmd2	UTSW	4	128496188	missense	possibly damaging	0.91
R1019:Csmd2	UTSW	4	128522014	missense	probably benign	0.00
R1476:Csmd2	UTSW	4	128487001	missense	probably benign	0.08
R1641:Csmd2	UTSW	4	128483395	missense	possibly damaging	0.68
R1709:Csmd2	UTSW	4	128496195	missense	probably damaging	0.96
R2866:Csmd2	UTSW	4	128414392	critical splice donor site	probably null
R2870:Csmd2	UTSW	4	128557718	missense	unknown
R2870:Csmd2	UTSW	4	128557718	missense	unknown
R2871:Csmd2	UTSW	4	128557718	missense	unknown
R2871:Csmd2	UTSW	4	128557718	missense	unknown
R2872:Csmd2	UTSW	4	128557718	missense	unknown
R2872:Csmd2	UTSW	4	128557718	missense	unknown
R2873:Csmd2	UTSW	4	128557718	missense	unknown
R2893:Csmd2	UTSW	4	128538993	splice site	probably null
R3796:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3797:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3798:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3914:Csmd2	UTSW	4	128321324	missense	probably benign	0.07
R4198:Csmd2	UTSW	4	128510924	missense	probably benign	0.07
R4489:Csmd2	UTSW	4	128381945	missense	possibly damaging	0.68
R4571:Csmd2	UTSW	4	128480095	splice site	probably null
R4581:Csmd2	UTSW	4	128369088	missense	probably benign	0.02
R4599:Csmd2	UTSW	4	127988128	missense	probably benign	0.35
R4649:Csmd2	UTSW	4	128546073	missense	probably benign
R4706:Csmd2	UTSW	4	128544751	missense	probably benign
R4776:Csmd2	UTSW	4	128442892	missense	probably benign	0.09
R4838:Csmd2	UTSW	4	128517749	missense	probably benign
R4900:Csmd2	UTSW	4	128452525	missense	probably benign	0.03
R4999:Csmd2	UTSW	4	128521930	missense	probably benign	0.00
R5024:Csmd2	UTSW	4	128321348	missense	possibly damaging	0.94
R5034:Csmd2	UTSW	4	128059108	missense	probably damaging	0.98
R5152:Csmd2	UTSW	4	128552035	missense	probably benign	0.27
R5172:Csmd2	UTSW	4	128477397	missense	probably benign	0.10
R5231:Csmd2	UTSW	4	128546049	missense	probably benign	0.00
R5279:Csmd2	UTSW	4	128456914	missense	probably benign	0.30
R5287:Csmd2	UTSW	4	128486884	missense	probably benign	0.01
R5403:Csmd2	UTSW	4	128486884	missense	probably benign	0.01
R5410:Csmd2	UTSW	4	128548819	missense	probably benign
R5551:Csmd2	UTSW	4	128510948	missense	possibly damaging	0.83
R5566:Csmd2	UTSW	4	128462889	critical splice donor site	probably null
R5826:Csmd2	UTSW	4	128519199	splice site	probably null
R5907:Csmd2	UTSW	4	128197385	missense	probably damaging	0.99
R5913:Csmd2	UTSW	4	128551988	missense	probably benign	0.01
R5970:Csmd2	UTSW	4	128546151	missense	probably benign	0.00
R5977:Csmd2	UTSW	4	128059034	missense	probably damaging	1.00
R6027:Csmd2	UTSW	4	128559946	missense	unknown
R6075:Csmd2	UTSW	4	128486865	missense	probably benign	0.15
R6129:Csmd2	UTSW	4	128493334	missense	possibly damaging	0.79
R6363:Csmd2	UTSW	4	128400379	missense	probably benign	0.00
R6366:Csmd2	UTSW	4	128483452	missense	probably benign	0.00
R6404:Csmd2	UTSW	4	128521950	missense	possibly damaging	0.90
R6437:Csmd2	UTSW	4	127988100	missense	probably benign	0.24
R6441:Csmd2	UTSW	4	128394964	missense	probably benign	0.03
R6643:Csmd2	UTSW	4	128372597	missense	probably benign	0.14
R6724:Csmd2	UTSW	4	128563371	missense	probably damaging	0.97
R6734:Csmd2	UTSW	4	128463813	missense	probably benign	0.00
R6750:Csmd2	UTSW	4	128197225	missense	possibly damaging	0.91
R6801:Csmd2	UTSW	4	128383950	missense	probably benign	0.11
R6842:Csmd2	UTSW	4	128509159	missense	possibly damaging	0.72
R6843:Csmd2	UTSW	4	128463794	missense	probably benign	0.27
R6868:Csmd2	UTSW	4	128442840	missense	probably benign
R6882:Csmd2	UTSW	4	128449269	missense	probably benign	0.01
R7019:Csmd2	UTSW	4	128369063	missense
R7028:Csmd2	UTSW	4	128277228	missense
R7096:Csmd2	UTSW	4	128462726	missense
R7122:Csmd2	UTSW	4	128449227	missense
R7125:Csmd2	UTSW	4	128496162	missense
R7197:Csmd2	UTSW	4	128511033	missense
R7234:Csmd2	UTSW	4	128456779	missense
R7299:Csmd2	UTSW	4	128528262	missense
R7301:Csmd2	UTSW	4	128528262	missense
R7319:Csmd2	UTSW	4	128393679	missense
R7331:Csmd2	UTSW	4	128564228	splice site	probably null
R7332:Csmd2	UTSW	4	128419567	missense
R7352:Csmd2	UTSW	4	128557636	missense
R7402:Csmd2	UTSW	4	128322095	missense
R7402:Csmd2	UTSW	4	128322096	missense
R7474:Csmd2	UTSW	4	128546127	missense
R7555:Csmd2	UTSW	4	128452458	missense
R7592:Csmd2	UTSW	4	128463798	missense
R7700:Csmd2	UTSW	4	128545756	splice site	probably null
R7714:Csmd2	UTSW	4	128382950	nonsense	probably null
R7734:Csmd2	UTSW	4	128552057	missense
R7735:Csmd2	UTSW	4	128456930	critical splice donor site	probably null
R7757:Csmd2	UTSW	4	128483456	missense
R7805:Csmd2	UTSW	4	128419573	missense
R7823:Csmd2	UTSW	4	128209905	missense
R7904:Csmd2	UTSW	4	128419553	missense
R7946:Csmd2	UTSW	4	128520265	missense
R7964:Csmd2	UTSW	4	128523510	missense
R7968:Csmd2	UTSW	4	128197325	missense
R8003:Csmd2	UTSW	4	128539187	nonsense	probably null
R8071:Csmd2	UTSW	4	128393538	missense
R8504:Csmd2	UTSW	4	128546690	missense
R8511:Csmd2	UTSW	4	128368899	missense
R8517:Csmd2	UTSW	4	128552686	missense
R8704:Csmd2	UTSW	4	128197354	missense
R8722:Csmd2	UTSW	4	128551950	unclassified	probably benign
R8729:Csmd2	UTSW	4	128462845	missense
R8801:Csmd2	UTSW	4	128563402	missense	probably damaging	0.97
R8803:Csmd2	UTSW	4	128546684	missense
R8867:Csmd2	UTSW	4	128557676	missense
R8913:Csmd2	UTSW	4	128523558	missense
R8928:Csmd2	UTSW	4	128475789	missense
R8974:Csmd2	UTSW	4	128552587	missense
R9001:Csmd2	UTSW	4	128414286	missense
R9132:Csmd2	UTSW	4	128549214	missense
R9245:Csmd2	UTSW	4	128306375	missense
R9249:Csmd2	UTSW	4	128419530	nonsense	probably null
R9254:Csmd2	UTSW	4	128197319	missense
R9265:Csmd2	UTSW	4	128400370	missense
R9407:Csmd2	UTSW	4	128548820	missense
R9432:Csmd2	UTSW	4	128277211	missense
R9559:Csmd2	UTSW	4	128544768	missense
R9673:Csmd2	UTSW	4	128414269	missense
R9735:Csmd2	UTSW	4	128509108	missense
R9749:Csmd2	UTSW	4	128496128	missense
R9803:Csmd2	UTSW	4	128369193	missense
Z1177:Csmd2	UTSW	4	128530797	missense

Predicted Primers

PCR Primer
(F):5'- CACAGAAGAAGTCCACGATGTG -3'
(R):5'- TGCACTGCATATACACTGTGTG -3'

Sequencing Primer
(F):5'- AAGTCCACGATGTGCTGCG -3'
(R):5'- ACACTAACTGGTCTAGGTCAGCTG -3'

Posted On

2021-07-15