Incidental Mutation 'R8839:Csmd2'
ID 674308
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene Name CUB and Sushi multiple domains 2
Synonyms
MMRRC Submission 068667-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R8839 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 127881650-128461449 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 128336681 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 1420 (I1420L)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000184063]
AlphaFold no structure available at present
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T C 11: 105,889,194 (GRCm39) Y475H probably damaging Het
Ankfy1 T C 11: 72,621,392 (GRCm39) I226T probably benign Het
Anln G A 9: 22,267,468 (GRCm39) S825L probably benign Het
Aoc1l2 T C 6: 48,907,974 (GRCm39) Y325H probably damaging Het
Arb2a A T 13: 78,147,781 (GRCm39) H283L probably benign Het
B3galt4 A G 17: 34,169,867 (GRCm39) S124P possibly damaging Het
Cabin1 T C 10: 75,492,650 (GRCm39) I1882V probably benign Het
Caprin2 A T 6: 148,774,525 (GRCm39) S262R probably benign Het
Cyp2b9 T G 7: 25,900,185 (GRCm39) V331G probably damaging Het
Cyp3a59 A T 5: 146,045,896 (GRCm39) M433L probably benign Het
Edrf1 A G 7: 133,255,644 (GRCm39) D597G probably benign Het
Emc3 G A 6: 113,496,931 (GRCm39) R147C possibly damaging Het
Fkbp7 T C 2: 76,497,581 (GRCm39) probably benign Het
Flii T C 11: 60,609,433 (GRCm39) T665A possibly damaging Het
Fxr1 A G 3: 34,100,831 (GRCm39) probably benign Het
Gpr37 T G 6: 25,669,369 (GRCm39) I492L probably benign Het
Hmg20b A C 10: 81,184,749 (GRCm39) W108G probably damaging Het
Ighv9-3 G A 12: 114,104,385 (GRCm39) T93I possibly damaging Het
Inpp5a T C 7: 138,969,349 (GRCm39) V15A probably benign Het
Inpp5d T A 1: 87,619,433 (GRCm39) Y376N probably damaging Het
Ints6 A G 14: 62,931,122 (GRCm39) F854L probably benign Het
Ipo7 A T 7: 109,641,223 (GRCm39) K314N probably damaging Het
Ltn1 C A 16: 87,215,390 (GRCm39) C415F probably damaging Het
Mfsd9 T C 1: 40,813,554 (GRCm39) T254A probably benign Het
Musk A G 4: 58,286,151 (GRCm39) T14A probably benign Het
Ncapd3 T C 9: 27,005,730 (GRCm39) V1438A Het
Nnt A T 13: 119,494,173 (GRCm39) V636D unknown Het
Or10ak14 A G 4: 118,611,411 (GRCm39) L110P probably damaging Het
Or11h23 A T 14: 50,947,957 (GRCm39) T57S possibly damaging Het
Or52ae9 A G 7: 103,390,021 (GRCm39) I142T probably benign Het
Ost4 T C 5: 31,064,935 (GRCm39) probably benign Het
Pdzph1 T C 17: 59,257,237 (GRCm39) T934A probably benign Het
Plekhn1 T A 4: 156,307,046 (GRCm39) probably benign Het
Prkd1 T C 12: 50,389,616 (GRCm39) probably benign Het
Ptch1 A T 13: 63,689,038 (GRCm39) L413Q probably damaging Het
S100pbp A G 4: 129,076,000 (GRCm39) probably null Het
Sec23a T C 12: 59,037,781 (GRCm39) K361E possibly damaging Het
Sema3b C T 9: 107,478,552 (GRCm39) probably benign Het
Serpina3g A G 12: 104,204,038 (GRCm39) probably benign Het
Slc23a2 C T 2: 131,943,392 (GRCm39) silent Het
Smug1 T C 15: 103,064,247 (GRCm39) R225G possibly damaging Het
Srbd1 T A 17: 86,295,849 (GRCm39) I854L probably benign Het
Tbc1d16 G A 11: 119,047,474 (GRCm39) R417C probably damaging Het
Tiam1 A G 16: 89,681,827 (GRCm39) Y384H probably damaging Het
Trappc9 T A 15: 72,930,087 (GRCm39) K90* probably null Het
Tubgcp6 A T 15: 88,987,681 (GRCm39) H1097Q possibly damaging Het
Ugt2b37 A G 5: 87,402,415 (GRCm39) L72P probably damaging Het
Vmn2r20 A T 6: 123,373,515 (GRCm39) H442Q possibly damaging Het
Vmn2r65 A T 7: 84,595,489 (GRCm39) Y398* probably null Het
Zfhx4 A G 3: 5,466,915 (GRCm39) T2383A probably benign Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128,377,266 (GRCm39) missense probably benign 0.03
IGL01098:Csmd2 APN 4 127,952,845 (GRCm39) missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128,262,923 (GRCm39) missense probably benign 0.04
IGL01364:Csmd2 APN 4 128,308,081 (GRCm39) missense probably benign 0.01
IGL01530:Csmd2 APN 4 128,308,094 (GRCm39) missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128,457,098 (GRCm39) nonsense probably null
IGL01670:Csmd2 APN 4 128,407,164 (GRCm39) splice site probably benign
IGL01707:Csmd2 APN 4 128,276,798 (GRCm39) missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128,374,638 (GRCm39) splice site probably benign
IGL01837:Csmd2 APN 4 128,313,363 (GRCm39) missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128,453,740 (GRCm39) missense unknown
IGL02013:Csmd2 APN 4 128,215,116 (GRCm39) missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128,453,672 (GRCm39) missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128,371,263 (GRCm39) splice site probably benign
IGL02303:Csmd2 APN 4 128,262,801 (GRCm39) missense probably benign 0.01
IGL02317:Csmd2 APN 4 128,357,520 (GRCm39) splice site probably benign
IGL02322:Csmd2 APN 4 128,357,520 (GRCm39) splice site probably benign
IGL02338:Csmd2 APN 4 128,288,859 (GRCm39) missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128,407,165 (GRCm39) splice site probably benign
IGL02428:Csmd2 APN 4 128,368,609 (GRCm39) missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128,428,050 (GRCm39) missense probably benign
IGL02701:Csmd2 APN 4 128,389,934 (GRCm39) missense probably benign 0.17
IGL02801:Csmd2 APN 4 128,445,868 (GRCm39) splice site probably null
IGL02818:Csmd2 APN 4 128,103,521 (GRCm39) missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128,415,677 (GRCm39) missense probably benign 0.00
IGL02876:Csmd2 APN 4 128,215,128 (GRCm39) nonsense probably null
IGL02977:Csmd2 APN 4 128,387,069 (GRCm39) nonsense probably null
IGL03006:Csmd2 APN 4 128,374,558 (GRCm39) splice site probably benign
IGL03032:Csmd2 APN 4 128,412,834 (GRCm39) missense probably benign 0.03
IGL03148:Csmd2 APN 4 128,278,062 (GRCm39) missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128,308,092 (GRCm39) nonsense probably null
IGL03245:Csmd2 APN 4 128,402,915 (GRCm39) missense probably benign 0.12
IGL03376:Csmd2 APN 4 128,411,464 (GRCm39) missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128,190,222 (GRCm39) missense probably benign 0.01
R0109:Csmd2 UTSW 4 128,438,536 (GRCm39) missense probably benign 0.03
R0112:Csmd2 UTSW 4 128,389,822 (GRCm39) missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128,415,704 (GRCm39) missense probably benign 0.02
R0390:Csmd2 UTSW 4 128,027,466 (GRCm39) intron probably benign
R0441:Csmd2 UTSW 4 128,414,023 (GRCm39) missense probably benign 0.00
R0519:Csmd2 UTSW 4 128,380,798 (GRCm39) missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128,007,469 (GRCm39) missense probably benign 0.00
R0746:Csmd2 UTSW 4 128,308,090 (GRCm39) missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128,389,981 (GRCm39) missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128,415,807 (GRCm39) missense probably benign 0.00
R1476:Csmd2 UTSW 4 128,380,794 (GRCm39) missense probably benign 0.08
R1641:Csmd2 UTSW 4 128,377,188 (GRCm39) missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128,389,988 (GRCm39) missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128,308,185 (GRCm39) critical splice donor site probably null
R2870:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2870:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2871:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2871:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2872:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2872:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2873:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2893:Csmd2 UTSW 4 128,432,786 (GRCm39) splice site probably null
R3796:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3797:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3798:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3914:Csmd2 UTSW 4 128,215,117 (GRCm39) missense probably benign 0.07
R4198:Csmd2 UTSW 4 128,404,717 (GRCm39) missense probably benign 0.07
R4489:Csmd2 UTSW 4 128,275,738 (GRCm39) missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128,373,888 (GRCm39) splice site probably null
R4581:Csmd2 UTSW 4 128,262,881 (GRCm39) missense probably benign 0.02
R4599:Csmd2 UTSW 4 127,881,921 (GRCm39) missense probably benign 0.35
R4649:Csmd2 UTSW 4 128,439,866 (GRCm39) missense probably benign
R4706:Csmd2 UTSW 4 128,438,544 (GRCm39) missense probably benign
R4776:Csmd2 UTSW 4 128,336,685 (GRCm39) missense probably benign 0.09
R4838:Csmd2 UTSW 4 128,411,542 (GRCm39) missense probably benign
R4900:Csmd2 UTSW 4 128,346,318 (GRCm39) missense probably benign 0.03
R4999:Csmd2 UTSW 4 128,415,723 (GRCm39) missense probably benign 0.00
R5024:Csmd2 UTSW 4 128,215,141 (GRCm39) missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 127,952,901 (GRCm39) missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128,445,828 (GRCm39) missense probably benign 0.27
R5172:Csmd2 UTSW 4 128,371,190 (GRCm39) missense probably benign 0.10
R5231:Csmd2 UTSW 4 128,439,842 (GRCm39) missense probably benign 0.00
R5279:Csmd2 UTSW 4 128,350,707 (GRCm39) missense probably benign 0.30
R5287:Csmd2 UTSW 4 128,380,677 (GRCm39) missense probably benign 0.01
R5403:Csmd2 UTSW 4 128,380,677 (GRCm39) missense probably benign 0.01
R5410:Csmd2 UTSW 4 128,442,612 (GRCm39) missense probably benign
R5551:Csmd2 UTSW 4 128,404,741 (GRCm39) missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128,356,682 (GRCm39) critical splice donor site probably null
R5826:Csmd2 UTSW 4 128,412,992 (GRCm39) splice site probably null
R5907:Csmd2 UTSW 4 128,091,178 (GRCm39) missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128,445,781 (GRCm39) missense probably benign 0.01
R5970:Csmd2 UTSW 4 128,439,944 (GRCm39) missense probably benign 0.00
R5977:Csmd2 UTSW 4 127,952,827 (GRCm39) missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128,453,739 (GRCm39) missense unknown
R6075:Csmd2 UTSW 4 128,380,658 (GRCm39) missense probably benign 0.15
R6129:Csmd2 UTSW 4 128,387,127 (GRCm39) missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128,294,172 (GRCm39) missense probably benign 0.00
R6366:Csmd2 UTSW 4 128,377,245 (GRCm39) missense probably benign 0.00
R6404:Csmd2 UTSW 4 128,415,743 (GRCm39) missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127,881,893 (GRCm39) missense probably benign 0.24
R6441:Csmd2 UTSW 4 128,288,757 (GRCm39) missense probably benign 0.03
R6643:Csmd2 UTSW 4 128,266,390 (GRCm39) missense probably benign 0.14
R6724:Csmd2 UTSW 4 128,457,164 (GRCm39) missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128,357,606 (GRCm39) missense probably benign 0.00
R6750:Csmd2 UTSW 4 128,091,018 (GRCm39) missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128,277,743 (GRCm39) missense probably benign 0.11
R6842:Csmd2 UTSW 4 128,402,952 (GRCm39) missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128,357,587 (GRCm39) missense probably benign 0.27
R6868:Csmd2 UTSW 4 128,336,633 (GRCm39) missense probably benign
R6882:Csmd2 UTSW 4 128,343,062 (GRCm39) missense probably benign 0.01
R7019:Csmd2 UTSW 4 128,262,856 (GRCm39) missense
R7028:Csmd2 UTSW 4 128,171,021 (GRCm39) missense
R7096:Csmd2 UTSW 4 128,356,519 (GRCm39) missense
R7122:Csmd2 UTSW 4 128,343,020 (GRCm39) missense
R7125:Csmd2 UTSW 4 128,389,955 (GRCm39) missense
R7197:Csmd2 UTSW 4 128,404,826 (GRCm39) missense
R7234:Csmd2 UTSW 4 128,350,572 (GRCm39) missense
R7299:Csmd2 UTSW 4 128,422,055 (GRCm39) missense
R7301:Csmd2 UTSW 4 128,422,055 (GRCm39) missense
R7319:Csmd2 UTSW 4 128,287,472 (GRCm39) missense
R7331:Csmd2 UTSW 4 128,458,021 (GRCm39) splice site probably null
R7332:Csmd2 UTSW 4 128,313,360 (GRCm39) missense
R7352:Csmd2 UTSW 4 128,451,429 (GRCm39) missense
R7402:Csmd2 UTSW 4 128,215,889 (GRCm39) missense
R7402:Csmd2 UTSW 4 128,215,888 (GRCm39) missense
R7474:Csmd2 UTSW 4 128,439,920 (GRCm39) missense
R7555:Csmd2 UTSW 4 128,346,251 (GRCm39) missense
R7592:Csmd2 UTSW 4 128,357,591 (GRCm39) missense
R7700:Csmd2 UTSW 4 128,439,549 (GRCm39) splice site probably null
R7714:Csmd2 UTSW 4 128,276,743 (GRCm39) nonsense probably null
R7734:Csmd2 UTSW 4 128,445,850 (GRCm39) missense
R7735:Csmd2 UTSW 4 128,350,723 (GRCm39) critical splice donor site probably null
R7757:Csmd2 UTSW 4 128,377,249 (GRCm39) missense
R7805:Csmd2 UTSW 4 128,313,366 (GRCm39) missense
R7823:Csmd2 UTSW 4 128,103,698 (GRCm39) missense
R7904:Csmd2 UTSW 4 128,313,346 (GRCm39) missense
R7946:Csmd2 UTSW 4 128,414,058 (GRCm39) missense
R7964:Csmd2 UTSW 4 128,417,303 (GRCm39) missense
R7968:Csmd2 UTSW 4 128,091,118 (GRCm39) missense
R8003:Csmd2 UTSW 4 128,432,980 (GRCm39) nonsense probably null
R8071:Csmd2 UTSW 4 128,287,331 (GRCm39) missense
R8504:Csmd2 UTSW 4 128,440,483 (GRCm39) missense
R8511:Csmd2 UTSW 4 128,262,692 (GRCm39) missense
R8517:Csmd2 UTSW 4 128,446,479 (GRCm39) missense
R8704:Csmd2 UTSW 4 128,091,147 (GRCm39) missense
R8722:Csmd2 UTSW 4 128,445,743 (GRCm39) unclassified probably benign
R8729:Csmd2 UTSW 4 128,356,638 (GRCm39) missense
R8801:Csmd2 UTSW 4 128,457,195 (GRCm39) missense probably damaging 0.97
R8803:Csmd2 UTSW 4 128,440,477 (GRCm39) missense
R8867:Csmd2 UTSW 4 128,451,469 (GRCm39) missense
R8913:Csmd2 UTSW 4 128,417,351 (GRCm39) missense
R8928:Csmd2 UTSW 4 128,369,582 (GRCm39) missense
R8974:Csmd2 UTSW 4 128,446,380 (GRCm39) missense
R9001:Csmd2 UTSW 4 128,308,079 (GRCm39) missense
R9132:Csmd2 UTSW 4 128,443,007 (GRCm39) missense
R9245:Csmd2 UTSW 4 128,200,168 (GRCm39) missense
R9249:Csmd2 UTSW 4 128,313,323 (GRCm39) nonsense probably null
R9254:Csmd2 UTSW 4 128,091,112 (GRCm39) missense
R9265:Csmd2 UTSW 4 128,294,163 (GRCm39) missense
R9407:Csmd2 UTSW 4 128,442,613 (GRCm39) missense
R9432:Csmd2 UTSW 4 128,171,004 (GRCm39) missense
R9559:Csmd2 UTSW 4 128,438,561 (GRCm39) missense
R9673:Csmd2 UTSW 4 128,308,062 (GRCm39) missense
R9735:Csmd2 UTSW 4 128,402,901 (GRCm39) missense
R9749:Csmd2 UTSW 4 128,389,921 (GRCm39) missense
R9803:Csmd2 UTSW 4 128,262,986 (GRCm39) missense
Z1177:Csmd2 UTSW 4 128,424,590 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CACAGAAGAAGTCCACGATGTG -3'
(R):5'- TGCACTGCATATACACTGTGTG -3'

Sequencing Primer
(F):5'- AAGTCCACGATGTGCTGCG -3'
(R):5'- ACACTAACTGGTCTAGGTCAGCTG -3'
Posted On 2021-07-15