Incidental Mutation 'R8839:Emc3'
ID 674315
Institutional Source Beutler Lab
Gene Symbol Emc3
Ensembl Gene ENSMUSG00000030286
Gene Name ER membrane protein complex subunit 3
Synonyms 0610039A15Rik, Tmem111
MMRRC Submission 068667-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8839 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 113491848-113508599 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 113496931 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 147 (R147C)
Ref Sequence ENSEMBL: ENSMUSP00000032425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032425]
AlphaFold Q99KI3
Predicted Effect possibly damaging
Transcript: ENSMUST00000032425
AA Change: R147C

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032425
Gene: ENSMUSG00000030286
AA Change: R147C

DomainStartEndE-ValueType
Pfam:DUF106 5 191 6.2e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T C 11: 105,889,194 (GRCm39) Y475H probably damaging Het
Ankfy1 T C 11: 72,621,392 (GRCm39) I226T probably benign Het
Anln G A 9: 22,267,468 (GRCm39) S825L probably benign Het
Aoc1l2 T C 6: 48,907,974 (GRCm39) Y325H probably damaging Het
Arb2a A T 13: 78,147,781 (GRCm39) H283L probably benign Het
B3galt4 A G 17: 34,169,867 (GRCm39) S124P possibly damaging Het
Cabin1 T C 10: 75,492,650 (GRCm39) I1882V probably benign Het
Caprin2 A T 6: 148,774,525 (GRCm39) S262R probably benign Het
Csmd2 A C 4: 128,336,681 (GRCm39) I1420L Het
Cyp2b9 T G 7: 25,900,185 (GRCm39) V331G probably damaging Het
Cyp3a59 A T 5: 146,045,896 (GRCm39) M433L probably benign Het
Edrf1 A G 7: 133,255,644 (GRCm39) D597G probably benign Het
Fkbp7 T C 2: 76,497,581 (GRCm39) probably benign Het
Flii T C 11: 60,609,433 (GRCm39) T665A possibly damaging Het
Fxr1 A G 3: 34,100,831 (GRCm39) probably benign Het
Gpr37 T G 6: 25,669,369 (GRCm39) I492L probably benign Het
Hmg20b A C 10: 81,184,749 (GRCm39) W108G probably damaging Het
Ighv9-3 G A 12: 114,104,385 (GRCm39) T93I possibly damaging Het
Inpp5a T C 7: 138,969,349 (GRCm39) V15A probably benign Het
Inpp5d T A 1: 87,619,433 (GRCm39) Y376N probably damaging Het
Ints6 A G 14: 62,931,122 (GRCm39) F854L probably benign Het
Ipo7 A T 7: 109,641,223 (GRCm39) K314N probably damaging Het
Ltn1 C A 16: 87,215,390 (GRCm39) C415F probably damaging Het
Mfsd9 T C 1: 40,813,554 (GRCm39) T254A probably benign Het
Musk A G 4: 58,286,151 (GRCm39) T14A probably benign Het
Ncapd3 T C 9: 27,005,730 (GRCm39) V1438A Het
Nnt A T 13: 119,494,173 (GRCm39) V636D unknown Het
Or10ak14 A G 4: 118,611,411 (GRCm39) L110P probably damaging Het
Or11h23 A T 14: 50,947,957 (GRCm39) T57S possibly damaging Het
Or52ae9 A G 7: 103,390,021 (GRCm39) I142T probably benign Het
Ost4 T C 5: 31,064,935 (GRCm39) probably benign Het
Pdzph1 T C 17: 59,257,237 (GRCm39) T934A probably benign Het
Plekhn1 T A 4: 156,307,046 (GRCm39) probably benign Het
Prkd1 T C 12: 50,389,616 (GRCm39) probably benign Het
Ptch1 A T 13: 63,689,038 (GRCm39) L413Q probably damaging Het
S100pbp A G 4: 129,076,000 (GRCm39) probably null Het
Sec23a T C 12: 59,037,781 (GRCm39) K361E possibly damaging Het
Sema3b C T 9: 107,478,552 (GRCm39) probably benign Het
Serpina3g A G 12: 104,204,038 (GRCm39) probably benign Het
Slc23a2 C T 2: 131,943,392 (GRCm39) silent Het
Smug1 T C 15: 103,064,247 (GRCm39) R225G possibly damaging Het
Srbd1 T A 17: 86,295,849 (GRCm39) I854L probably benign Het
Tbc1d16 G A 11: 119,047,474 (GRCm39) R417C probably damaging Het
Tiam1 A G 16: 89,681,827 (GRCm39) Y384H probably damaging Het
Trappc9 T A 15: 72,930,087 (GRCm39) K90* probably null Het
Tubgcp6 A T 15: 88,987,681 (GRCm39) H1097Q possibly damaging Het
Ugt2b37 A G 5: 87,402,415 (GRCm39) L72P probably damaging Het
Vmn2r20 A T 6: 123,373,515 (GRCm39) H442Q possibly damaging Het
Vmn2r65 A T 7: 84,595,489 (GRCm39) Y398* probably null Het
Zfhx4 A G 3: 5,466,915 (GRCm39) T2383A probably benign Het
Other mutations in Emc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01775:Emc3 APN 6 113,508,296 (GRCm39) missense possibly damaging 0.82
IGL02347:Emc3 APN 6 113,497,533 (GRCm39) missense possibly damaging 0.50
R0044:Emc3 UTSW 6 113,508,344 (GRCm39) missense probably benign 0.05
R0626:Emc3 UTSW 6 113,492,992 (GRCm39) missense probably benign
R4736:Emc3 UTSW 6 113,508,310 (GRCm39) missense possibly damaging 0.71
R7062:Emc3 UTSW 6 113,499,757 (GRCm39) missense probably damaging 0.97
R7128:Emc3 UTSW 6 113,494,881 (GRCm39) missense probably damaging 1.00
R7183:Emc3 UTSW 6 113,508,345 (GRCm39) nonsense probably null
R8510:Emc3 UTSW 6 113,508,350 (GRCm39) missense probably damaging 1.00
R8817:Emc3 UTSW 6 113,492,868 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTGGCATTTCAAATAGAGC -3'
(R):5'- CCTCAGGGAAATCAGAGCAG -3'

Sequencing Primer
(F):5'- AGCTTTCATTTAAGAGAGAGAAAGAG -3'
(R):5'- TCAGAGCAGAGTGACATTTTAGCTG -3'
Posted On 2021-07-15