Incidental Mutation 'R8839:Cyp2b9'
ID674318
Institutional Source Beutler Lab
Gene Symbol Cyp2b9
Ensembl Gene ENSMUSG00000040660
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 9
Synonyms16\alphaoh-a, phenobarbitol inducible, type a, Cyp2b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R8839 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location26173411-26210661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 26200760 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 331 (V331G)
Ref Sequence ENSEMBL: ENSMUSP00000080846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082214]
Predicted Effect probably damaging
Transcript: ENSMUST00000082214
AA Change: V331G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080846
Gene: ENSMUSG00000040660
AA Change: V331G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:p450 31 488 1.7e-146 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,040 Y325H probably damaging Het
Ace3 T C 11: 105,998,368 Y475H probably damaging Het
Ankfy1 T C 11: 72,730,566 I226T probably benign Het
Anln G A 9: 22,356,172 S825L probably benign Het
B3galt4 A G 17: 33,950,893 S124P possibly damaging Het
Cabin1 T C 10: 75,656,816 I1882V probably benign Het
Caprin2 A T 6: 148,873,027 S262R probably benign Het
Csmd2 A C 4: 128,442,888 I1420L Het
Cyp3a59 A T 5: 146,109,086 M433L probably benign Het
Edrf1 A G 7: 133,653,915 D597G probably benign Het
Emc3 G A 6: 113,519,970 R147C possibly damaging Het
Fam172a A T 13: 77,999,662 H283L probably benign Het
Flii T C 11: 60,718,607 T665A possibly damaging Het
Gpr37 T G 6: 25,669,370 I492L probably benign Het
Hmg20b A C 10: 81,348,915 W108G probably damaging Het
Ighv9-3 G A 12: 114,140,765 T93I possibly damaging Het
Inpp5a T C 7: 139,389,433 V15A probably benign Het
Inpp5d T A 1: 87,691,711 Y376N probably damaging Het
Ints6 A G 14: 62,693,673 F854L probably benign Het
Ipo7 A T 7: 110,042,016 K314N probably damaging Het
Ltn1 C A 16: 87,418,502 C415F probably damaging Het
Mfsd9 T C 1: 40,774,394 T254A probably benign Het
Musk A G 4: 58,286,151 T14A probably benign Het
Ncapd3 T C 9: 27,094,434 V1438A Het
Nnt A T 13: 119,357,637 V636D unknown Het
Olfr1338 A G 4: 118,754,214 L110P probably damaging Het
Olfr629 A G 7: 103,740,814 I142T probably benign Het
Olfr748 A T 14: 50,710,500 T57S possibly damaging Het
Ost4 T C 5: 30,907,591 probably benign Het
Pdzph1 T C 17: 58,950,242 T934A probably benign Het
Ptch1 A T 13: 63,541,224 L413Q probably damaging Het
S100pbp A G 4: 129,182,207 probably null Het
Sec23a T C 12: 58,990,995 K361E possibly damaging Het
Serpina3g A G 12: 104,237,779 probably benign Het
Smug1 T C 15: 103,155,820 R225G possibly damaging Het
Srbd1 T A 17: 85,988,421 I854L probably benign Het
Tbc1d16 G A 11: 119,156,648 R417C probably damaging Het
Tiam1 A G 16: 89,884,939 Y384H probably damaging Het
Trappc9 T A 15: 73,058,238 K90* probably null Het
Tubgcp6 A T 15: 89,103,478 H1097Q possibly damaging Het
Ugt2b37 A G 5: 87,254,556 L72P probably damaging Het
Vmn2r20 A T 6: 123,396,556 H442Q possibly damaging Het
Vmn2r65 A T 7: 84,946,281 Y398* probably null Het
Zfhx4 A G 3: 5,401,855 T2383A probably benign Het
Other mutations in Cyp2b9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Cyp2b9 APN 7 26198505 missense probably damaging 0.99
IGL01133:Cyp2b9 APN 7 26210235 missense probably damaging 1.00
IGL01331:Cyp2b9 APN 7 26187715 missense probably damaging 0.99
IGL02281:Cyp2b9 APN 7 26201104 missense probably damaging 0.99
IGL02502:Cyp2b9 APN 7 26187814 critical splice donor site probably null
IGL02713:Cyp2b9 APN 7 26173520 missense probably benign 0.12
IGL03032:Cyp2b9 APN 7 26198600 splice site probably benign
IGL03307:Cyp2b9 APN 7 26199051 missense probably benign 0.00
R0010:Cyp2b9 UTSW 7 26186753 splice site probably benign
R0025:Cyp2b9 UTSW 7 26200813 missense probably benign 0.09
R0040:Cyp2b9 UTSW 7 26173474 missense possibly damaging 0.68
R0184:Cyp2b9 UTSW 7 26187007 nonsense probably null
R0370:Cyp2b9 UTSW 7 26210106 missense probably damaging 1.00
R1595:Cyp2b9 UTSW 7 26200907 missense possibly damaging 0.72
R1751:Cyp2b9 UTSW 7 26186675 missense probably benign 0.05
R1835:Cyp2b9 UTSW 7 26200783 missense probably benign
R1879:Cyp2b9 UTSW 7 26198569 missense probably damaging 0.99
R2256:Cyp2b9 UTSW 7 26173605 critical splice donor site probably null
R2257:Cyp2b9 UTSW 7 26173605 critical splice donor site probably null
R2418:Cyp2b9 UTSW 7 26186707 missense probably benign 0.00
R3420:Cyp2b9 UTSW 7 26210103 missense probably damaging 1.00
R4088:Cyp2b9 UTSW 7 26173456 missense probably damaging 0.99
R4412:Cyp2b9 UTSW 7 26198443 missense probably damaging 1.00
R4495:Cyp2b9 UTSW 7 26200755 missense probably benign 0.00
R4615:Cyp2b9 UTSW 7 26201125 missense probably damaging 1.00
R5375:Cyp2b9 UTSW 7 26187742 missense probably damaging 1.00
R5426:Cyp2b9 UTSW 7 26187655 missense probably benign
R5862:Cyp2b9 UTSW 7 26187807 missense probably benign 0.01
R6237:Cyp2b9 UTSW 7 26173574 missense probably benign 0.02
R6445:Cyp2b9 UTSW 7 26186987 missense probably benign 0.13
R6992:Cyp2b9 UTSW 7 26201139 missense probably benign 0.00
R7515:Cyp2b9 UTSW 7 26199171 missense probably damaging 1.00
R7654:Cyp2b9 UTSW 7 26186942 missense possibly damaging 0.72
R7816:Cyp2b9 UTSW 7 26201092 missense probably benign 0.01
R7850:Cyp2b9 UTSW 7 26186686 nonsense probably null
R8734:Cyp2b9 UTSW 7 26198610 intron probably benign
Z1177:Cyp2b9 UTSW 7 26201163 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGAGGTTGAAGCTCATGGAG -3'
(R):5'- GGAATCAAAGCTGGTCTCACC -3'

Sequencing Primer
(F):5'- TAGTTTTAAACATGGGCATGGAG -3'
(R):5'- ATCAAAGCTGGTCTCACCTTGGG -3'
Posted On2021-07-15