Incidental Mutation 'R0730:Clk1'
Institutional Source Beutler Lab
Gene Symbol Clk1
Ensembl Gene ENSMUSG00000026034
Gene NameCDC-like kinase 1
SynonymsClk1, STY
MMRRC Submission 038911-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0730 (G1)
Quality Score225
Status Validated
Chromosomal Location58410189-58424066 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58414399 bp
Amino Acid Change Histidine to Tyrosine at position 343 (H343Y)
Ref Sequence ENSEMBL: ENSMUSP00000034868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034868] [ENSMUST00000148330] [ENSMUST00000151338]
Predicted Effect probably benign
Transcript: ENSMUST00000034868
AA Change: H343Y

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034868
Gene: ENSMUSG00000026034
AA Change: H343Y

low complexity region 23 37 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 99 139 N/A INTRINSIC
S_TKc 160 476 3.55e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141570
Predicted Effect probably benign
Transcript: ENSMUST00000148330
SMART Domains Protein: ENSMUSP00000137649
Gene: ENSMUSG00000026034

low complexity region 23 37 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 99 129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151338
SMART Domains Protein: ENSMUSP00000137815
Gene: ENSMUSG00000026034

low complexity region 23 37 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 99 129 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186552
Meta Mutation Damage Score 0.7490 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CDC2-like (or LAMMER) family of dual specificity protein kinases. In the nucleus, the encoded protein phosphorylates serine/arginine-rich proteins involved in pre-mRNA processing, releasing them into the nucleoplasm. The choice of splice sites during pre-mRNA processing may be regulated by the concentration of transacting factors, including serine/arginine rich proteins. Therefore, the encoded protein may play an indirect role in governing splice site selection. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T A 3: 108,469,535 H509L probably benign Het
9930021J03Rik T A 19: 29,717,981 I1438F probably benign Het
Adam9 A T 8: 24,996,758 I168N probably benign Het
Adamts20 G A 15: 94,347,690 A577V probably benign Het
Agtr1a A T 13: 30,381,296 S115C probably damaging Het
Ankrd11 T C 8: 122,891,953 Y1720C probably damaging Het
Ano6 A T 15: 95,920,371 T353S probably damaging Het
App A G 16: 85,079,952 F184L probably damaging Het
Arhgef38 T A 3: 133,137,471 Y446F probably benign Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Atp1a4 G A 1: 172,240,207 probably benign Het
Bdp1 G A 13: 100,058,951 probably benign Het
Bicd2 T A 13: 49,378,241 S246T possibly damaging Het
Bsn T A 9: 108,106,812 M3348L unknown Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cacna2d3 T C 14: 28,982,365 I820V probably benign Het
Cdc40 A G 10: 40,844,956 probably benign Het
Cdh23 T C 10: 60,323,714 E2094G probably damaging Het
Celsr2 T A 3: 108,398,606 N2061Y probably damaging Het
Cfap206 G A 4: 34,711,391 A502V probably benign Het
Cfap54 T C 10: 93,034,737 T29A probably benign Het
Cfap57 T C 4: 118,612,920 probably null Het
Chd5 A G 4: 152,347,984 E43G possibly damaging Het
Cntn4 A C 6: 106,550,486 K443T probably damaging Het
Csn2 G A 5: 87,694,952 A72V possibly damaging Het
Ctdp1 T A 18: 80,450,242 H346L probably benign Het
Ctif A T 18: 75,565,012 N192K probably damaging Het
Ddr2 G A 1: 169,995,566 A383V probably benign Het
Derl3 C T 10: 75,895,242 probably benign Het
Dgkh T C 14: 78,584,479 I865V probably damaging Het
Dip2b C T 15: 100,171,651 A619V probably damaging Het
Eml1 A G 12: 108,530,326 T614A possibly damaging Het
Eogt G C 6: 97,116,009 Y402* probably null Het
Erbb4 A G 1: 68,259,290 V647A probably damaging Het
Esm1 G T 13: 113,213,502 probably null Het
Fbxo31 A G 8: 121,555,364 probably benign Het
Fbxw5 T A 2: 25,504,618 D201E possibly damaging Het
Fgfr1 G A 8: 25,555,744 D123N probably benign Het
G530012D18Rik A C 1: 85,577,036 probably benign Het
Gnat1 G A 9: 107,679,463 T29I probably damaging Het
Gtf2ird2 A T 5: 134,192,758 R67* probably null Het
Iltifb A T 10: 118,294,237 D87E probably benign Het
Kcnq3 T C 15: 65,995,608 T729A probably benign Het
Klrc2 A T 6: 129,658,696 S156R probably damaging Het
Krt76 A T 15: 101,887,349 L462Q probably damaging Het
Lama3 C A 18: 12,456,850 probably benign Het
Lin28a A T 4: 134,008,008 S56T probably damaging Het
Macf1 A G 4: 123,382,530 probably benign Het
Macrod2 C T 2: 142,217,674 probably benign Het
Mansc1 C T 6: 134,617,461 probably benign Het
Map1b G T 13: 99,429,766 S2149* probably null Het
Mgst1 A T 6: 138,147,669 T34S probably benign Het
Mlf2 C T 6: 124,934,391 T123M probably damaging Het
Mospd2 C T X: 164,948,257 probably benign Het
Mrpl15 A T 1: 4,777,611 V155E probably damaging Het
Mstn A T 1: 53,061,794 Y10F possibly damaging Het
Myo1g C T 11: 6,520,794 V21M probably damaging Het
Myom2 T C 8: 15,099,326 I599T probably benign Het
Ndc80 A T 17: 71,496,246 N633K probably benign Het
Nhs C A X: 161,837,300 V1487L possibly damaging Het
Npc1 T C 18: 12,219,325 T106A probably benign Het
Nup133 C T 8: 123,949,008 V57M probably benign Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr1045 A G 2: 86,198,725 V9A probably benign Het
Olfr1106 T C 2: 87,049,148 I29M probably benign Het
Olfr818 T A 10: 129,945,111 H317L probably benign Het
Oprm1 T C 10: 6,832,652 probably benign Het
Ostf1 C T 19: 18,604,207 V14I unknown Het
Pcdhb14 C A 18: 37,448,868 D342E probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pdpr T C 8: 111,125,755 probably null Het
Plce1 G A 19: 38,716,691 V847M probably damaging Het
Pon3 A G 6: 5,230,444 M288T probably benign Het
Psd2 A T 18: 35,978,574 D84V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ralgapa1 T C 12: 55,665,663 K1808E probably damaging Het
Ramp3 T C 11: 6,676,476 probably benign Het
Rasgrf1 T A 9: 89,951,009 probably benign Het
Rictor A G 15: 6,773,986 probably benign Het
Rptor A T 11: 119,884,954 I984F probably benign Het
Slc1a6 C T 10: 78,796,008 P223S probably benign Het
Taar8b A C 10: 24,092,026 V90G probably damaging Het
Tbc1d21 A G 9: 58,359,877 V327A probably benign Het
Tex21 T C 12: 76,204,166 T499A probably benign Het
Tg A T 15: 66,678,789 D256V probably damaging Het
Tmf1 A G 6: 97,176,492 S207P probably benign Het
Tpr A G 1: 150,393,407 probably benign Het
Ufd1 A G 16: 18,814,887 T21A probably damaging Het
Unc13a T C 8: 71,656,285 D115G possibly damaging Het
Usb1 T A 8: 95,344,041 F198L probably damaging Het
Utrn A T 10: 12,698,158 probably benign Het
Vars A G 17: 35,014,300 N954S probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr33 C T 18: 31,835,376 probably benign Het
Zfp236 A G 18: 82,640,244 probably benign Het
Zfp445 A T 9: 122,861,758 V124E probably damaging Het
Zfp616 A T 11: 74,084,822 H639L probably damaging Het
Zfyve16 C A 13: 92,521,477 S642I probably damaging Het
Zswim5 C T 4: 116,985,746 T896I possibly damaging Het
Other mutations in Clk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Clk1 APN 1 58413452 missense possibly damaging 0.93
IGL01516:Clk1 APN 1 58414404 missense probably damaging 1.00
IGL01684:Clk1 APN 1 58417265 critical splice donor site probably null
IGL02621:Clk1 APN 1 58414455 missense probably damaging 1.00
IGL02812:Clk1 APN 1 58414476 missense probably damaging 0.98
IGL03028:Clk1 APN 1 58421102 nonsense probably null
IGL03117:Clk1 APN 1 58417007 splice site probably null
PIT4243001:Clk1 UTSW 1 58419677 missense probably damaging 1.00
R0149:Clk1 UTSW 1 58414601 missense probably damaging 1.00
R0309:Clk1 UTSW 1 58413033 splice site probably benign
R1570:Clk1 UTSW 1 58414425 missense probably benign 0.28
R1729:Clk1 UTSW 1 58421261 missense probably damaging 1.00
R1905:Clk1 UTSW 1 58421942 splice site probably benign
R2382:Clk1 UTSW 1 58421289 missense probably benign 0.01
R2850:Clk1 UTSW 1 58412279 missense probably damaging 1.00
R4658:Clk1 UTSW 1 58412987 missense probably benign 0.01
R4846:Clk1 UTSW 1 58421102 missense probably benign 0.33
R5011:Clk1 UTSW 1 58414483 missense probably benign
R5196:Clk1 UTSW 1 58414613 missense probably benign 0.00
R5699:Clk1 UTSW 1 58420195 missense probably damaging 1.00
R5838:Clk1 UTSW 1 58412660 missense probably damaging 1.00
R5839:Clk1 UTSW 1 58421915 missense probably benign 0.09
R6697:Clk1 UTSW 1 58414622 missense probably benign 0.21
R7293:Clk1 UTSW 1 58414613 missense probably benign 0.00
R7332:Clk1 UTSW 1 58412694 missense probably benign 0.16
R7663:Clk1 UTSW 1 58421160 missense probably damaging 1.00
R8550:Clk1 UTSW 1 58412676 missense probably damaging 0.99
Z1176:Clk1 UTSW 1 58417372 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cacacacctttaatcccaacac -3'
Posted On2013-09-03