Incidental Mutation 'R8839:Edrf1'
ID674322
Institutional Source Beutler Lab
Gene Symbol Edrf1
Ensembl Gene ENSMUSG00000039990
Gene Nameerythroid differentiation regulatory factor 1
Synonyms2700050L05Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock #R8839 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location133637543-133672971 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133653915 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 597 (D597G)
Ref Sequence ENSEMBL: ENSMUSP00000059166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051169] [ENSMUST00000128901] [ENSMUST00000138370]
Predicted Effect probably benign
Transcript: ENSMUST00000051169
AA Change: D597G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000059166
Gene: ENSMUSG00000039990
AA Change: D597G

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1229 1237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128901
AA Change: D563G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000115641
Gene: ENSMUSG00000039990
AA Change: D563G

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 433 443 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 1137 1150 N/A INTRINSIC
low complexity region 1195 1203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138370
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene may play a role in erythroid cell differentiation. The encoded protein inhibits DNA binding of the erythroid transcription factor GATA-1 and may regulate the expression of alpha-globin and gamma-globin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,040 Y325H probably damaging Het
Ace3 T C 11: 105,998,368 Y475H probably damaging Het
Ankfy1 T C 11: 72,730,566 I226T probably benign Het
Anln G A 9: 22,356,172 S825L probably benign Het
B3galt4 A G 17: 33,950,893 S124P possibly damaging Het
Cabin1 T C 10: 75,656,816 I1882V probably benign Het
Caprin2 A T 6: 148,873,027 S262R probably benign Het
Csmd2 A C 4: 128,442,888 I1420L Het
Cyp2b9 T G 7: 26,200,760 V331G probably damaging Het
Cyp3a59 A T 5: 146,109,086 M433L probably benign Het
Emc3 G A 6: 113,519,970 R147C possibly damaging Het
Fam172a A T 13: 77,999,662 H283L probably benign Het
Flii T C 11: 60,718,607 T665A possibly damaging Het
Gpr37 T G 6: 25,669,370 I492L probably benign Het
Hmg20b A C 10: 81,348,915 W108G probably damaging Het
Ighv9-3 G A 12: 114,140,765 T93I possibly damaging Het
Inpp5a T C 7: 139,389,433 V15A probably benign Het
Inpp5d T A 1: 87,691,711 Y376N probably damaging Het
Ints6 A G 14: 62,693,673 F854L probably benign Het
Ipo7 A T 7: 110,042,016 K314N probably damaging Het
Ltn1 C A 16: 87,418,502 C415F probably damaging Het
Mfsd9 T C 1: 40,774,394 T254A probably benign Het
Musk A G 4: 58,286,151 T14A probably benign Het
Ncapd3 T C 9: 27,094,434 V1438A Het
Nnt A T 13: 119,357,637 V636D unknown Het
Olfr1338 A G 4: 118,754,214 L110P probably damaging Het
Olfr629 A G 7: 103,740,814 I142T probably benign Het
Olfr748 A T 14: 50,710,500 T57S possibly damaging Het
Ost4 T C 5: 30,907,591 probably benign Het
Pdzph1 T C 17: 58,950,242 T934A probably benign Het
Ptch1 A T 13: 63,541,224 L413Q probably damaging Het
S100pbp A G 4: 129,182,207 probably null Het
Sec23a T C 12: 58,990,995 K361E possibly damaging Het
Serpina3g A G 12: 104,237,779 probably benign Het
Smug1 T C 15: 103,155,820 R225G possibly damaging Het
Srbd1 T A 17: 85,988,421 I854L probably benign Het
Tbc1d16 G A 11: 119,156,648 R417C probably damaging Het
Tiam1 A G 16: 89,884,939 Y384H probably damaging Het
Trappc9 T A 15: 73,058,238 K90* probably null Het
Tubgcp6 A T 15: 89,103,478 H1097Q possibly damaging Het
Ugt2b37 A G 5: 87,254,556 L72P probably damaging Het
Vmn2r20 A T 6: 123,396,556 H442Q possibly damaging Het
Vmn2r65 A T 7: 84,946,281 Y398* probably null Het
Zfhx4 A G 3: 5,401,855 T2383A probably benign Het
Other mutations in Edrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Edrf1 APN 7 133658553 nonsense probably null
IGL01637:Edrf1 APN 7 133650525 missense probably damaging 1.00
IGL01697:Edrf1 APN 7 133643730 missense probably benign 0.02
IGL01893:Edrf1 APN 7 133657102 missense probably benign 0.09
IGL02202:Edrf1 APN 7 133656970 missense probably benign 0.00
IGL02278:Edrf1 APN 7 133657000 missense probably benign 0.00
IGL02382:Edrf1 APN 7 133650615 splice site probably benign
IGL02743:Edrf1 APN 7 133656491 unclassified probably benign
R0265:Edrf1 UTSW 7 133657045 missense probably damaging 1.00
R0282:Edrf1 UTSW 7 133644022 missense probably benign 0.21
R1167:Edrf1 UTSW 7 133644066 missense probably benign 0.08
R1633:Edrf1 UTSW 7 133652140 missense probably damaging 1.00
R2039:Edrf1 UTSW 7 133653949 nonsense probably null
R2060:Edrf1 UTSW 7 133657129 nonsense probably null
R2920:Edrf1 UTSW 7 133667572 missense probably benign 0.00
R4770:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R4887:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R4888:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R5135:Edrf1 UTSW 7 133651044 missense probably benign 0.03
R5156:Edrf1 UTSW 7 133660179 missense probably damaging 1.00
R5290:Edrf1 UTSW 7 133650566 missense probably damaging 0.98
R5342:Edrf1 UTSW 7 133651910 splice site probably null
R5416:Edrf1 UTSW 7 133641402 missense possibly damaging 0.52
R5450:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R5906:Edrf1 UTSW 7 133663415 missense probably benign
R6272:Edrf1 UTSW 7 133637808 start gained probably benign
R6275:Edrf1 UTSW 7 133667582 missense possibly damaging 0.60
R7144:Edrf1 UTSW 7 133637849 missense probably benign
R7244:Edrf1 UTSW 7 133654350 missense probably benign 0.01
R7716:Edrf1 UTSW 7 133643726 missense probably damaging 0.99
R8193:Edrf1 UTSW 7 133661877 missense possibly damaging 0.95
R8197:Edrf1 UTSW 7 133647359 missense probably benign 0.41
R8553:Edrf1 UTSW 7 133650318 missense possibly damaging 0.88
R8710:Edrf1 UTSW 7 133643766 missense probably damaging 1.00
R9035:Edrf1 UTSW 7 133643702 missense probably damaging 0.97
R9051:Edrf1 UTSW 7 133671478 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAAGATTTGAAACAGTGCTG -3'
(R):5'- CTACATATGATCTGAAAGACTTGGG -3'

Sequencing Primer
(F):5'- CAGTGCTGAAAACATTTGTATCAG -3'
(R):5'- CTGAAAGACTTGGGAAAATGATTTG -3'
Posted On2021-07-15