Incidental Mutation 'R8839:Cabin1'
ID 674326
Institutional Source Beutler Lab
Gene Symbol Cabin1
Ensembl Gene ENSMUSG00000020196
Gene Name calcineurin binding protein 1
Synonyms A330070M20Rik, Ppp3in, Cain
MMRRC Submission 068667-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8839 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 75481946-75600175 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75492650 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1882 (I1882V)
Ref Sequence ENSEMBL: ENSMUSP00000001712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001712]
AlphaFold G3X8Q1
Predicted Effect probably benign
Transcript: ENSMUST00000001712
AA Change: I1882V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000001712
Gene: ENSMUSG00000020196
AA Change: I1882V

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
TPR 90 123 4.15e-2 SMART
TPR 124 157 5.69e0 SMART
low complexity region 312 326 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
TPR 615 648 9.7e0 SMART
low complexity region 740 750 N/A INTRINSIC
low complexity region 882 892 N/A INTRINSIC
TPR 1055 1088 6.92e1 SMART
low complexity region 1327 1349 N/A INTRINSIC
low complexity region 1714 1727 N/A INTRINSIC
low complexity region 1778 1790 N/A INTRINSIC
low complexity region 1791 1803 N/A INTRINSIC
low complexity region 1810 1831 N/A INTRINSIC
low complexity region 1941 1956 N/A INTRINSIC
Pfam:MEF2_binding 2123 2157 5.7e-26 PFAM
low complexity region 2165 2183 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcineurin plays an important role in the T-cell receptor-mediated signal transduction pathway. The protein encoded by this gene binds specifically to the activated form of calcineurin and inhibits calcineurin-mediated signal transduction. The encoded protein is found in the nucleus and contains a leucine zipper domain as well as several PEST motifs, sequences which confer targeted degradation to those proteins which contain them. Alternative splicing results in multiple transcript variants encoding two different isoforms. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous null mutants exhibit embryonic lethality during organogenesis. Mice producing a truncated protein exhibit elevated levels of serum IgG1, IgG2b and IgE, produce more IgG1 in response to T-cell dependent antigen, and have enhanced expression of cytokines in response to anti-CD3 stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T C 11: 105,889,194 (GRCm39) Y475H probably damaging Het
Ankfy1 T C 11: 72,621,392 (GRCm39) I226T probably benign Het
Anln G A 9: 22,267,468 (GRCm39) S825L probably benign Het
Aoc1l2 T C 6: 48,907,974 (GRCm39) Y325H probably damaging Het
Arb2a A T 13: 78,147,781 (GRCm39) H283L probably benign Het
B3galt4 A G 17: 34,169,867 (GRCm39) S124P possibly damaging Het
Caprin2 A T 6: 148,774,525 (GRCm39) S262R probably benign Het
Csmd2 A C 4: 128,336,681 (GRCm39) I1420L Het
Cyp2b9 T G 7: 25,900,185 (GRCm39) V331G probably damaging Het
Cyp3a59 A T 5: 146,045,896 (GRCm39) M433L probably benign Het
Edrf1 A G 7: 133,255,644 (GRCm39) D597G probably benign Het
Emc3 G A 6: 113,496,931 (GRCm39) R147C possibly damaging Het
Fkbp7 T C 2: 76,497,581 (GRCm39) probably benign Het
Flii T C 11: 60,609,433 (GRCm39) T665A possibly damaging Het
Fxr1 A G 3: 34,100,831 (GRCm39) probably benign Het
Gpr37 T G 6: 25,669,369 (GRCm39) I492L probably benign Het
Hmg20b A C 10: 81,184,749 (GRCm39) W108G probably damaging Het
Ighv9-3 G A 12: 114,104,385 (GRCm39) T93I possibly damaging Het
Inpp5a T C 7: 138,969,349 (GRCm39) V15A probably benign Het
Inpp5d T A 1: 87,619,433 (GRCm39) Y376N probably damaging Het
Ints6 A G 14: 62,931,122 (GRCm39) F854L probably benign Het
Ipo7 A T 7: 109,641,223 (GRCm39) K314N probably damaging Het
Ltn1 C A 16: 87,215,390 (GRCm39) C415F probably damaging Het
Mfsd9 T C 1: 40,813,554 (GRCm39) T254A probably benign Het
Musk A G 4: 58,286,151 (GRCm39) T14A probably benign Het
Ncapd3 T C 9: 27,005,730 (GRCm39) V1438A Het
Nnt A T 13: 119,494,173 (GRCm39) V636D unknown Het
Or10ak14 A G 4: 118,611,411 (GRCm39) L110P probably damaging Het
Or11h23 A T 14: 50,947,957 (GRCm39) T57S possibly damaging Het
Or52ae9 A G 7: 103,390,021 (GRCm39) I142T probably benign Het
Ost4 T C 5: 31,064,935 (GRCm39) probably benign Het
Pdzph1 T C 17: 59,257,237 (GRCm39) T934A probably benign Het
Plekhn1 T A 4: 156,307,046 (GRCm39) probably benign Het
Prkd1 T C 12: 50,389,616 (GRCm39) probably benign Het
Ptch1 A T 13: 63,689,038 (GRCm39) L413Q probably damaging Het
S100pbp A G 4: 129,076,000 (GRCm39) probably null Het
Sec23a T C 12: 59,037,781 (GRCm39) K361E possibly damaging Het
Sema3b C T 9: 107,478,552 (GRCm39) probably benign Het
Serpina3g A G 12: 104,204,038 (GRCm39) probably benign Het
Slc23a2 C T 2: 131,943,392 (GRCm39) silent Het
Smug1 T C 15: 103,064,247 (GRCm39) R225G possibly damaging Het
Srbd1 T A 17: 86,295,849 (GRCm39) I854L probably benign Het
Tbc1d16 G A 11: 119,047,474 (GRCm39) R417C probably damaging Het
Tiam1 A G 16: 89,681,827 (GRCm39) Y384H probably damaging Het
Trappc9 T A 15: 72,930,087 (GRCm39) K90* probably null Het
Tubgcp6 A T 15: 88,987,681 (GRCm39) H1097Q possibly damaging Het
Ugt2b37 A G 5: 87,402,415 (GRCm39) L72P probably damaging Het
Vmn2r20 A T 6: 123,373,515 (GRCm39) H442Q possibly damaging Het
Vmn2r65 A T 7: 84,595,489 (GRCm39) Y398* probably null Het
Zfhx4 A G 3: 5,466,915 (GRCm39) T2383A probably benign Het
Other mutations in Cabin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Cabin1 APN 10 75,561,420 (GRCm39) missense possibly damaging 0.58
IGL01457:Cabin1 APN 10 75,578,263 (GRCm39) missense probably damaging 0.96
IGL02217:Cabin1 APN 10 75,535,881 (GRCm39) missense possibly damaging 0.95
IGL02649:Cabin1 APN 10 75,573,252 (GRCm39) missense probably damaging 1.00
IGL02737:Cabin1 APN 10 75,549,419 (GRCm39) missense probably benign 0.09
IGL02792:Cabin1 APN 10 75,582,573 (GRCm39) missense probably damaging 1.00
IGL03047:Cabin1 APN 10 75,535,934 (GRCm39) splice site probably benign
IGL03106:Cabin1 APN 10 75,569,462 (GRCm39) missense probably benign 0.01
IGL03276:Cabin1 APN 10 75,568,247 (GRCm39) missense probably damaging 1.00
bison UTSW 10 75,520,157 (GRCm39) missense probably damaging 1.00
range UTSW 10 75,494,481 (GRCm39) missense probably damaging 1.00
R0335:Cabin1 UTSW 10 75,492,883 (GRCm39) missense probably damaging 1.00
R0557:Cabin1 UTSW 10 75,562,751 (GRCm39) missense probably damaging 1.00
R0578:Cabin1 UTSW 10 75,549,444 (GRCm39) missense probably damaging 0.96
R0588:Cabin1 UTSW 10 75,581,171 (GRCm39) missense possibly damaging 0.71
R1115:Cabin1 UTSW 10 75,553,511 (GRCm39) missense possibly damaging 0.70
R1120:Cabin1 UTSW 10 75,561,550 (GRCm39) missense probably damaging 1.00
R1439:Cabin1 UTSW 10 75,492,640 (GRCm39) missense probably damaging 1.00
R1471:Cabin1 UTSW 10 75,530,626 (GRCm39) missense probably damaging 1.00
R1794:Cabin1 UTSW 10 75,561,579 (GRCm39) missense possibly damaging 0.52
R1844:Cabin1 UTSW 10 75,579,184 (GRCm39) splice site probably null
R1959:Cabin1 UTSW 10 75,570,924 (GRCm39) missense possibly damaging 0.92
R2008:Cabin1 UTSW 10 75,570,810 (GRCm39) splice site probably null
R2279:Cabin1 UTSW 10 75,589,295 (GRCm39) missense probably benign
R3150:Cabin1 UTSW 10 75,492,745 (GRCm39) missense probably damaging 1.00
R3929:Cabin1 UTSW 10 75,587,452 (GRCm39) critical splice acceptor site probably null
R3945:Cabin1 UTSW 10 75,581,093 (GRCm39) missense probably damaging 1.00
R3946:Cabin1 UTSW 10 75,581,093 (GRCm39) missense probably damaging 1.00
R4206:Cabin1 UTSW 10 75,590,675 (GRCm39) missense possibly damaging 0.69
R4812:Cabin1 UTSW 10 75,482,428 (GRCm39) missense possibly damaging 0.93
R4944:Cabin1 UTSW 10 75,575,255 (GRCm39) missense probably damaging 0.99
R4944:Cabin1 UTSW 10 75,557,197 (GRCm39) missense probably damaging 1.00
R5078:Cabin1 UTSW 10 75,557,312 (GRCm39) missense probably damaging 1.00
R5082:Cabin1 UTSW 10 75,574,164 (GRCm39) missense probably damaging 0.99
R5319:Cabin1 UTSW 10 75,561,549 (GRCm39) missense probably damaging 1.00
R5481:Cabin1 UTSW 10 75,570,900 (GRCm39) missense probably benign 0.29
R5504:Cabin1 UTSW 10 75,488,843 (GRCm39) missense probably benign 0.00
R5710:Cabin1 UTSW 10 75,482,852 (GRCm39) missense probably benign 0.00
R5908:Cabin1 UTSW 10 75,557,366 (GRCm39) missense probably damaging 1.00
R5975:Cabin1 UTSW 10 75,493,673 (GRCm39) missense probably damaging 1.00
R5982:Cabin1 UTSW 10 75,561,394 (GRCm39) missense probably benign 0.00
R6038:Cabin1 UTSW 10 75,575,200 (GRCm39) missense probably benign 0.02
R6038:Cabin1 UTSW 10 75,575,200 (GRCm39) missense probably benign 0.02
R6114:Cabin1 UTSW 10 75,583,805 (GRCm39) missense probably benign 0.00
R6285:Cabin1 UTSW 10 75,520,157 (GRCm39) missense probably damaging 1.00
R6341:Cabin1 UTSW 10 75,494,573 (GRCm39) missense probably damaging 0.98
R6361:Cabin1 UTSW 10 75,562,699 (GRCm39) missense possibly damaging 0.91
R6395:Cabin1 UTSW 10 75,582,576 (GRCm39) missense probably benign 0.10
R6422:Cabin1 UTSW 10 75,492,626 (GRCm39) missense probably damaging 1.00
R6575:Cabin1 UTSW 10 75,561,535 (GRCm39) missense possibly damaging 0.90
R6763:Cabin1 UTSW 10 75,582,564 (GRCm39) missense probably damaging 0.99
R6845:Cabin1 UTSW 10 75,557,342 (GRCm39) missense probably damaging 1.00
R6936:Cabin1 UTSW 10 75,551,592 (GRCm39) splice site probably null
R7050:Cabin1 UTSW 10 75,549,376 (GRCm39) missense probably damaging 1.00
R7055:Cabin1 UTSW 10 75,579,117 (GRCm39) missense probably benign 0.04
R7101:Cabin1 UTSW 10 75,587,401 (GRCm39) missense probably benign
R7138:Cabin1 UTSW 10 75,581,187 (GRCm39) missense probably damaging 0.98
R7173:Cabin1 UTSW 10 75,582,396 (GRCm39) missense probably benign 0.00
R7265:Cabin1 UTSW 10 75,557,257 (GRCm39) missense
R7284:Cabin1 UTSW 10 75,530,668 (GRCm39) missense
R7472:Cabin1 UTSW 10 75,494,481 (GRCm39) missense probably damaging 1.00
R7571:Cabin1 UTSW 10 75,482,500 (GRCm39) missense probably damaging 1.00
R7617:Cabin1 UTSW 10 75,568,277 (GRCm39) missense possibly damaging 0.85
R7739:Cabin1 UTSW 10 75,494,492 (GRCm39) missense probably damaging 1.00
R7997:Cabin1 UTSW 10 75,569,609 (GRCm39) missense probably benign 0.01
R8347:Cabin1 UTSW 10 75,578,201 (GRCm39) missense probably damaging 0.98
R8544:Cabin1 UTSW 10 75,585,890 (GRCm39) missense probably benign 0.17
R8546:Cabin1 UTSW 10 75,578,101 (GRCm39) missense probably damaging 1.00
R8692:Cabin1 UTSW 10 75,587,410 (GRCm39) missense probably benign 0.28
R9010:Cabin1 UTSW 10 75,570,892 (GRCm39) nonsense probably null
R9108:Cabin1 UTSW 10 75,492,973 (GRCm39) missense possibly damaging 0.94
R9204:Cabin1 UTSW 10 75,530,550 (GRCm39) missense probably benign 0.01
R9259:Cabin1 UTSW 10 75,582,576 (GRCm39) missense probably benign
R9312:Cabin1 UTSW 10 75,561,569 (GRCm39) missense probably benign 0.07
R9421:Cabin1 UTSW 10 75,493,658 (GRCm39) missense probably damaging 1.00
R9439:Cabin1 UTSW 10 75,581,069 (GRCm39) missense probably damaging 1.00
R9578:Cabin1 UTSW 10 75,590,185 (GRCm39) missense probably damaging 0.99
R9645:Cabin1 UTSW 10 75,494,543 (GRCm39) missense probably benign 0.36
R9649:Cabin1 UTSW 10 75,575,239 (GRCm39) missense probably damaging 0.98
R9711:Cabin1 UTSW 10 75,579,090 (GRCm39) missense probably benign 0.02
Z1177:Cabin1 UTSW 10 75,483,957 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CACAAAGTACAGAGTGTTCAAGC -3'
(R):5'- TCCTTAGAGGAGCTGAGTATCAG -3'

Sequencing Primer
(F):5'- GTGTTCAAGCAGGGGGC -3'
(R):5'- TGAGTATCAGCACCCGGC -3'
Posted On 2021-07-15