Incidental Mutation 'R8839:Sec23a'
ID674332
Institutional Source Beutler Lab
Gene Symbol Sec23a
Ensembl Gene ENSMUSG00000020986
Gene NameSEC23 homolog A, COPII coat complex component
SynonymsSec23r, Msec23
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.395) question?
Stock #R8839 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location58958383-59012017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58990995 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 361 (K361E)
Ref Sequence ENSEMBL: ENSMUSP00000021375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021375] [ENSMUST00000165134]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021375
AA Change: K361E

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021375
Gene: ENSMUSG00000020986
AA Change: K361E

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 58 98 2.7e-17 PFAM
Pfam:Sec23_trunk 126 390 2e-81 PFAM
Pfam:Sec23_BS 401 504 3.2e-35 PFAM
Pfam:Sec23_helical 520 618 1e-30 PFAM
Pfam:Gelsolin 629 718 9.3e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165134
AA Change: K332E

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126011
Gene: ENSMUSG00000020986
AA Change: K332E

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 57 98 8.1e-16 PFAM
Pfam:Sec23_trunk 97 361 6.5e-84 PFAM
Pfam:Sec23_BS 372 475 3.8e-36 PFAM
Pfam:Sec23_helical 490 590 1.6e-38 PFAM
Pfam:Gelsolin 599 689 2.7e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC23 subfamily of the SEC23/SEC24 family. It is part of a protein complex and found in the ribosome-free transitional face of the endoplasmic reticulum (ER) and associated vesicles. This protein has similarity to yeast Sec23p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The encoded protein is suggested to play a role in the ER-Golgi protein trafficking. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die during mid-embryogenesis exhibiting defects in neural tube closure and extraembryonic membrane formation as well as broad secretion defects of multiple collagen species in different tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,040 Y325H probably damaging Het
Ace3 T C 11: 105,998,368 Y475H probably damaging Het
Ankfy1 T C 11: 72,730,566 I226T probably benign Het
Anln G A 9: 22,356,172 S825L probably benign Het
B3galt4 A G 17: 33,950,893 S124P possibly damaging Het
Cabin1 T C 10: 75,656,816 I1882V probably benign Het
Caprin2 A T 6: 148,873,027 S262R probably benign Het
Csmd2 A C 4: 128,442,888 I1420L Het
Cyp2b9 T G 7: 26,200,760 V331G probably damaging Het
Cyp3a59 A T 5: 146,109,086 M433L probably benign Het
Edrf1 A G 7: 133,653,915 D597G probably benign Het
Emc3 G A 6: 113,519,970 R147C possibly damaging Het
Fam172a A T 13: 77,999,662 H283L probably benign Het
Flii T C 11: 60,718,607 T665A possibly damaging Het
Gpr37 T G 6: 25,669,370 I492L probably benign Het
Hmg20b A C 10: 81,348,915 W108G probably damaging Het
Ighv9-3 G A 12: 114,140,765 T93I possibly damaging Het
Inpp5a T C 7: 139,389,433 V15A probably benign Het
Inpp5d T A 1: 87,691,711 Y376N probably damaging Het
Ints6 A G 14: 62,693,673 F854L probably benign Het
Ipo7 A T 7: 110,042,016 K314N probably damaging Het
Ltn1 C A 16: 87,418,502 C415F probably damaging Het
Mfsd9 T C 1: 40,774,394 T254A probably benign Het
Musk A G 4: 58,286,151 T14A probably benign Het
Ncapd3 T C 9: 27,094,434 V1438A Het
Nnt A T 13: 119,357,637 V636D unknown Het
Olfr1338 A G 4: 118,754,214 L110P probably damaging Het
Olfr629 A G 7: 103,740,814 I142T probably benign Het
Olfr748 A T 14: 50,710,500 T57S possibly damaging Het
Ost4 T C 5: 30,907,591 probably benign Het
Pdzph1 T C 17: 58,950,242 T934A probably benign Het
Ptch1 A T 13: 63,541,224 L413Q probably damaging Het
S100pbp A G 4: 129,182,207 probably null Het
Serpina3g A G 12: 104,237,779 probably benign Het
Smug1 T C 15: 103,155,820 R225G possibly damaging Het
Srbd1 T A 17: 85,988,421 I854L probably benign Het
Tbc1d16 G A 11: 119,156,648 R417C probably damaging Het
Tiam1 A G 16: 89,884,939 Y384H probably damaging Het
Trappc9 T A 15: 73,058,238 K90* probably null Het
Tubgcp6 A T 15: 89,103,478 H1097Q possibly damaging Het
Ugt2b37 A G 5: 87,254,556 L72P probably damaging Het
Vmn2r20 A T 6: 123,396,556 H442Q possibly damaging Het
Vmn2r65 A T 7: 84,946,281 Y398* probably null Het
Zfhx4 A G 3: 5,401,855 T2383A probably benign Het
Other mutations in Sec23a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Sec23a APN 12 58992282 missense possibly damaging 0.47
IGL01836:Sec23a APN 12 58971287 missense probably damaging 0.98
IGL01906:Sec23a APN 12 59007044 missense probably damaging 1.00
IGL02383:Sec23a APN 12 59002027 missense probably damaging 1.00
IGL02507:Sec23a APN 12 59007098 missense probably benign 0.34
IGL02816:Sec23a APN 12 58978545 missense probably benign 0.03
IGL03060:Sec23a APN 12 58986105 missense probably benign
R0308:Sec23a UTSW 12 59007199 nonsense probably null
R0361:Sec23a UTSW 12 58991018 missense probably damaging 1.00
R0546:Sec23a UTSW 12 58985167 missense probably benign 0.07
R0720:Sec23a UTSW 12 58971271 missense probably damaging 1.00
R1084:Sec23a UTSW 12 58985135 missense probably damaging 0.97
R1156:Sec23a UTSW 12 59001836 missense probably benign
R1438:Sec23a UTSW 12 59002010 missense probably damaging 0.98
R1446:Sec23a UTSW 12 58978559 missense probably damaging 1.00
R1526:Sec23a UTSW 12 58986186 splice site probably null
R1705:Sec23a UTSW 12 59001866 missense possibly damaging 0.95
R1997:Sec23a UTSW 12 59002007 missense probably benign
R2051:Sec23a UTSW 12 58990968 splice site probably null
R2081:Sec23a UTSW 12 58998281 nonsense probably null
R4201:Sec23a UTSW 12 59002005 missense probably benign 0.00
R4706:Sec23a UTSW 12 58982586 missense probably damaging 0.98
R4724:Sec23a UTSW 12 58978506 missense probably damaging 0.99
R4969:Sec23a UTSW 12 59004488 critical splice donor site probably null
R5375:Sec23a UTSW 12 59007005 missense probably benign 0.15
R5858:Sec23a UTSW 12 58973035 missense probably damaging 0.98
R6539:Sec23a UTSW 12 58985212 missense probably benign 0.00
R6558:Sec23a UTSW 12 59004552 missense probably benign 0.03
R6616:Sec23a UTSW 12 58997155 missense possibly damaging 0.95
R6716:Sec23a UTSW 12 58968823 missense probably benign 0.09
R7078:Sec23a UTSW 12 58992283 missense probably benign 0.07
R7155:Sec23a UTSW 12 58989443 missense probably benign 0.03
R7367:Sec23a UTSW 12 58966999 missense probably benign
R7923:Sec23a UTSW 12 58992247 missense probably damaging 0.99
R8178:Sec23a UTSW 12 59007194 missense possibly damaging 0.93
R8557:Sec23a UTSW 12 59005270 missense probably damaging 0.96
Z1088:Sec23a UTSW 12 59004576 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCTGAACCCCTACTTCACTT -3'
(R):5'- AAGATTCATGGGATGGCGAG -3'

Sequencing Primer
(F):5'- CAGGGCCATTGCAAATGTTC -3'
(R):5'- CATGGGATGGCGAGGTTATATATTTG -3'
Posted On2021-07-15