Incidental Mutation 'R8839:Pdzph1'
ID674346
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene NamePDZ and pleckstrin homology domains 1
Synonyms2610034M16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R8839 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location58878808-58991375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58950242 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 934 (T934A)
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064]
Predicted Effect probably benign
Transcript: ENSMUST00000025064
AA Change: T934A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: T934A

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,040 Y325H probably damaging Het
Ace3 T C 11: 105,998,368 Y475H probably damaging Het
Ankfy1 T C 11: 72,730,566 I226T probably benign Het
Anln G A 9: 22,356,172 S825L probably benign Het
B3galt4 A G 17: 33,950,893 S124P possibly damaging Het
Cabin1 T C 10: 75,656,816 I1882V probably benign Het
Caprin2 A T 6: 148,873,027 S262R probably benign Het
Csmd2 A C 4: 128,442,888 I1420L Het
Cyp2b9 T G 7: 26,200,760 V331G probably damaging Het
Cyp3a59 A T 5: 146,109,086 M433L probably benign Het
Edrf1 A G 7: 133,653,915 D597G probably benign Het
Emc3 G A 6: 113,519,970 R147C possibly damaging Het
Fam172a A T 13: 77,999,662 H283L probably benign Het
Flii T C 11: 60,718,607 T665A possibly damaging Het
Gpr37 T G 6: 25,669,370 I492L probably benign Het
Hmg20b A C 10: 81,348,915 W108G probably damaging Het
Ighv9-3 G A 12: 114,140,765 T93I possibly damaging Het
Inpp5a T C 7: 139,389,433 V15A probably benign Het
Inpp5d T A 1: 87,691,711 Y376N probably damaging Het
Ints6 A G 14: 62,693,673 F854L probably benign Het
Ipo7 A T 7: 110,042,016 K314N probably damaging Het
Ltn1 C A 16: 87,418,502 C415F probably damaging Het
Mfsd9 T C 1: 40,774,394 T254A probably benign Het
Musk A G 4: 58,286,151 T14A probably benign Het
Ncapd3 T C 9: 27,094,434 V1438A Het
Nnt A T 13: 119,357,637 V636D unknown Het
Olfr1338 A G 4: 118,754,214 L110P probably damaging Het
Olfr629 A G 7: 103,740,814 I142T probably benign Het
Olfr748 A T 14: 50,710,500 T57S possibly damaging Het
Ost4 T C 5: 30,907,591 probably benign Het
Ptch1 A T 13: 63,541,224 L413Q probably damaging Het
S100pbp A G 4: 129,182,207 probably null Het
Sec23a T C 12: 58,990,995 K361E possibly damaging Het
Serpina3g A G 12: 104,237,779 probably benign Het
Smug1 T C 15: 103,155,820 R225G possibly damaging Het
Srbd1 T A 17: 85,988,421 I854L probably benign Het
Tbc1d16 G A 11: 119,156,648 R417C probably damaging Het
Tiam1 A G 16: 89,884,939 Y384H probably damaging Het
Trappc9 T A 15: 73,058,238 K90* probably null Het
Tubgcp6 A T 15: 89,103,478 H1097Q possibly damaging Het
Ugt2b37 A G 5: 87,254,556 L72P probably damaging Het
Vmn2r20 A T 6: 123,396,556 H442Q possibly damaging Het
Vmn2r65 A T 7: 84,946,281 Y398* probably null Het
Zfhx4 A G 3: 5,401,855 T2383A probably benign Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 58974796 missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 58888110 missense probably benign
IGL01413:Pdzph1 APN 17 58879152 missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 58922715 missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 58967339 missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 58967511 splice site probably benign
IGL02548:Pdzph1 APN 17 58973391 missense probably benign 0.10
IGL02618:Pdzph1 APN 17 58879073 utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 58880647 missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 58932483 missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 58974069 missense probably benign
IGL03304:Pdzph1 APN 17 58880646 missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 58974234 missense probably benign 0.00
R0008:Pdzph1 UTSW 17 58922761 splice site probably benign
R0008:Pdzph1 UTSW 17 58922761 splice site probably benign
R0498:Pdzph1 UTSW 17 58973830 missense probably benign 0.00
R0553:Pdzph1 UTSW 17 58922727 missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 58954479 missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 58932432 missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 58974087 missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 58974747 missense probably benign 0.10
R1463:Pdzph1 UTSW 17 58932445 missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 58973752 missense probably benign 0.16
R1773:Pdzph1 UTSW 17 58974813 missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 58922583 missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 58974097 missense probably benign 0.04
R2071:Pdzph1 UTSW 17 58974097 missense probably benign 0.04
R2229:Pdzph1 UTSW 17 58932412 splice site probably benign
R2264:Pdzph1 UTSW 17 58888167 critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 58922649 missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 58973336 nonsense probably null
R4700:Pdzph1 UTSW 17 58974546 missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 58973530 missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 58974756 missense probably benign 0.00
R5130:Pdzph1 UTSW 17 58922609 missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 58974880 missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 58973947 missense probably benign 0.00
R5770:Pdzph1 UTSW 17 58879151 missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 58885867 missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 58974412 missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 58973746 missense probably benign 0.02
R6158:Pdzph1 UTSW 17 58973627 missense probably damaging 0.96
R6813:Pdzph1 UTSW 17 58974436 missense probably benign 0.08
R7022:Pdzph1 UTSW 17 58974126 missense probably benign 0.02
R7395:Pdzph1 UTSW 17 58879159 missense possibly damaging 0.85
R7525:Pdzph1 UTSW 17 58967341 missense possibly damaging 0.73
R7944:Pdzph1 UTSW 17 58932460 missense probably damaging 1.00
R7945:Pdzph1 UTSW 17 58932460 missense probably damaging 1.00
R7992:Pdzph1 UTSW 17 58879110 missense possibly damaging 0.71
R8016:Pdzph1 UTSW 17 58932481 missense probably damaging 0.98
R8116:Pdzph1 UTSW 17 58975143 missense probably benign 0.01
R8273:Pdzph1 UTSW 17 58973014 missense probably benign 0.00
R8523:Pdzph1 UTSW 17 58884013 missense probably damaging 1.00
R8819:Pdzph1 UTSW 17 58880720 nonsense probably null
R8820:Pdzph1 UTSW 17 58880720 nonsense probably null
R8871:Pdzph1 UTSW 17 58888038 missense probably damaging 1.00
R8898:Pdzph1 UTSW 17 58974339 missense probably benign 0.00
R8959:Pdzph1 UTSW 17 58974604 missense probably damaging 0.97
X0028:Pdzph1 UTSW 17 58879121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATATGGTCATGGTCTGAGAACTTCTC -3'
(R):5'- GCTCAGAACATATCTATTAAGCCTGAC -3'

Sequencing Primer
(F):5'- GAGCCTAGGCTGTTTGAT -3'
(R):5'- TTAAGCCTGACATGGAATCAAACAG -3'
Posted On2021-07-15