Incidental Mutation 'R8839:Pdzph1'
ID 674346
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene Name PDZ and pleckstrin homology domains 1
Synonyms 2610034M16Rik
MMRRC Submission 068667-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R8839 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 59185803-59298344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59257237 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 934 (T934A)
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064]
AlphaFold Q8BGR1
Predicted Effect probably benign
Transcript: ENSMUST00000025064
AA Change: T934A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: T934A

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T C 11: 105,889,194 (GRCm39) Y475H probably damaging Het
Ankfy1 T C 11: 72,621,392 (GRCm39) I226T probably benign Het
Anln G A 9: 22,267,468 (GRCm39) S825L probably benign Het
Aoc1l2 T C 6: 48,907,974 (GRCm39) Y325H probably damaging Het
Arb2a A T 13: 78,147,781 (GRCm39) H283L probably benign Het
B3galt4 A G 17: 34,169,867 (GRCm39) S124P possibly damaging Het
Cabin1 T C 10: 75,492,650 (GRCm39) I1882V probably benign Het
Caprin2 A T 6: 148,774,525 (GRCm39) S262R probably benign Het
Csmd2 A C 4: 128,336,681 (GRCm39) I1420L Het
Cyp2b9 T G 7: 25,900,185 (GRCm39) V331G probably damaging Het
Cyp3a59 A T 5: 146,045,896 (GRCm39) M433L probably benign Het
Edrf1 A G 7: 133,255,644 (GRCm39) D597G probably benign Het
Emc3 G A 6: 113,496,931 (GRCm39) R147C possibly damaging Het
Fkbp7 T C 2: 76,497,581 (GRCm39) probably benign Het
Flii T C 11: 60,609,433 (GRCm39) T665A possibly damaging Het
Fxr1 A G 3: 34,100,831 (GRCm39) probably benign Het
Gpr37 T G 6: 25,669,369 (GRCm39) I492L probably benign Het
Hmg20b A C 10: 81,184,749 (GRCm39) W108G probably damaging Het
Ighv9-3 G A 12: 114,104,385 (GRCm39) T93I possibly damaging Het
Inpp5a T C 7: 138,969,349 (GRCm39) V15A probably benign Het
Inpp5d T A 1: 87,619,433 (GRCm39) Y376N probably damaging Het
Ints6 A G 14: 62,931,122 (GRCm39) F854L probably benign Het
Ipo7 A T 7: 109,641,223 (GRCm39) K314N probably damaging Het
Ltn1 C A 16: 87,215,390 (GRCm39) C415F probably damaging Het
Mfsd9 T C 1: 40,813,554 (GRCm39) T254A probably benign Het
Musk A G 4: 58,286,151 (GRCm39) T14A probably benign Het
Ncapd3 T C 9: 27,005,730 (GRCm39) V1438A Het
Nnt A T 13: 119,494,173 (GRCm39) V636D unknown Het
Or10ak14 A G 4: 118,611,411 (GRCm39) L110P probably damaging Het
Or11h23 A T 14: 50,947,957 (GRCm39) T57S possibly damaging Het
Or52ae9 A G 7: 103,390,021 (GRCm39) I142T probably benign Het
Ost4 T C 5: 31,064,935 (GRCm39) probably benign Het
Plekhn1 T A 4: 156,307,046 (GRCm39) probably benign Het
Prkd1 T C 12: 50,389,616 (GRCm39) probably benign Het
Ptch1 A T 13: 63,689,038 (GRCm39) L413Q probably damaging Het
S100pbp A G 4: 129,076,000 (GRCm39) probably null Het
Sec23a T C 12: 59,037,781 (GRCm39) K361E possibly damaging Het
Sema3b C T 9: 107,478,552 (GRCm39) probably benign Het
Serpina3g A G 12: 104,204,038 (GRCm39) probably benign Het
Slc23a2 C T 2: 131,943,392 (GRCm39) silent Het
Smug1 T C 15: 103,064,247 (GRCm39) R225G possibly damaging Het
Srbd1 T A 17: 86,295,849 (GRCm39) I854L probably benign Het
Tbc1d16 G A 11: 119,047,474 (GRCm39) R417C probably damaging Het
Tiam1 A G 16: 89,681,827 (GRCm39) Y384H probably damaging Het
Trappc9 T A 15: 72,930,087 (GRCm39) K90* probably null Het
Tubgcp6 A T 15: 88,987,681 (GRCm39) H1097Q possibly damaging Het
Ugt2b37 A G 5: 87,402,415 (GRCm39) L72P probably damaging Het
Vmn2r20 A T 6: 123,373,515 (GRCm39) H442Q possibly damaging Het
Vmn2r65 A T 7: 84,595,489 (GRCm39) Y398* probably null Het
Zfhx4 A G 3: 5,466,915 (GRCm39) T2383A probably benign Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 59,281,791 (GRCm39) missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 59,195,105 (GRCm39) missense probably benign
IGL01413:Pdzph1 APN 17 59,186,147 (GRCm39) missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 59,229,710 (GRCm39) missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 59,274,334 (GRCm39) missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 59,274,506 (GRCm39) splice site probably benign
IGL02548:Pdzph1 APN 17 59,280,386 (GRCm39) missense probably benign 0.10
IGL02618:Pdzph1 APN 17 59,186,068 (GRCm39) utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 59,187,642 (GRCm39) missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 59,239,478 (GRCm39) missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 59,281,064 (GRCm39) missense probably benign
IGL03304:Pdzph1 APN 17 59,187,641 (GRCm39) missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 59,281,229 (GRCm39) missense probably benign 0.00
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0498:Pdzph1 UTSW 17 59,280,825 (GRCm39) missense probably benign 0.00
R0553:Pdzph1 UTSW 17 59,229,722 (GRCm39) missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 59,261,474 (GRCm39) missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 59,239,427 (GRCm39) missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 59,281,082 (GRCm39) missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 59,281,742 (GRCm39) missense probably benign 0.10
R1463:Pdzph1 UTSW 17 59,239,440 (GRCm39) missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 59,280,747 (GRCm39) missense probably benign 0.16
R1773:Pdzph1 UTSW 17 59,281,808 (GRCm39) missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 59,229,578 (GRCm39) missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2071:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2229:Pdzph1 UTSW 17 59,239,407 (GRCm39) splice site probably benign
R2264:Pdzph1 UTSW 17 59,195,162 (GRCm39) critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 59,229,644 (GRCm39) missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 59,280,331 (GRCm39) nonsense probably null
R4700:Pdzph1 UTSW 17 59,281,541 (GRCm39) missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 59,280,525 (GRCm39) missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
R5130:Pdzph1 UTSW 17 59,229,604 (GRCm39) missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 59,281,875 (GRCm39) missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 59,280,942 (GRCm39) missense probably benign 0.00
R5770:Pdzph1 UTSW 17 59,186,146 (GRCm39) missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 59,192,862 (GRCm39) missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 59,281,407 (GRCm39) missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 59,280,741 (GRCm39) missense probably benign 0.02
R6158:Pdzph1 UTSW 17 59,280,622 (GRCm39) missense probably damaging 0.96
R6813:Pdzph1 UTSW 17 59,281,431 (GRCm39) missense probably benign 0.08
R7022:Pdzph1 UTSW 17 59,281,121 (GRCm39) missense probably benign 0.02
R7395:Pdzph1 UTSW 17 59,186,154 (GRCm39) missense possibly damaging 0.85
R7525:Pdzph1 UTSW 17 59,274,336 (GRCm39) missense possibly damaging 0.73
R7944:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7945:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7992:Pdzph1 UTSW 17 59,186,105 (GRCm39) missense possibly damaging 0.71
R8016:Pdzph1 UTSW 17 59,239,476 (GRCm39) missense probably damaging 0.98
R8116:Pdzph1 UTSW 17 59,282,138 (GRCm39) missense probably benign 0.01
R8273:Pdzph1 UTSW 17 59,280,009 (GRCm39) missense probably benign 0.00
R8523:Pdzph1 UTSW 17 59,191,008 (GRCm39) missense probably damaging 1.00
R8819:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8820:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8871:Pdzph1 UTSW 17 59,195,033 (GRCm39) missense probably damaging 1.00
R8898:Pdzph1 UTSW 17 59,281,334 (GRCm39) missense probably benign 0.00
R8959:Pdzph1 UTSW 17 59,281,599 (GRCm39) missense probably damaging 0.97
R9043:Pdzph1 UTSW 17 59,280,535 (GRCm39) missense probably benign 0.05
R9083:Pdzph1 UTSW 17 59,261,395 (GRCm39) missense possibly damaging 0.94
R9092:Pdzph1 UTSW 17 59,280,125 (GRCm39) missense probably damaging 1.00
R9682:Pdzph1 UTSW 17 59,257,262 (GRCm39) missense probably damaging 1.00
R9757:Pdzph1 UTSW 17 59,281,898 (GRCm39) nonsense probably null
R9774:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
X0028:Pdzph1 UTSW 17 59,186,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATATGGTCATGGTCTGAGAACTTCTC -3'
(R):5'- GCTCAGAACATATCTATTAAGCCTGAC -3'

Sequencing Primer
(F):5'- GAGCCTAGGCTGTTTGAT -3'
(R):5'- TTAAGCCTGACATGGAATCAAACAG -3'
Posted On 2021-07-15