Mutagenetix > Incidental Mutations

Incidental Mutation 'R0730:Atp1a4'

67436

Institutional Source

Beutler Lab

Gene Symbol

Atp1a4

Ensembl Gene

ENSMUSG00000007107

Gene Name

ATPase, Na+/K+ transporting, alpha 4 polypeptide

Synonyms

MMRRC Submission

038911-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0730 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

172223513-172258414 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 172240207 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000106874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111243]

Predicted Effect

probably benign
Transcript: ENSMUST00000111243

SMART Domains

Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107

Domain	Start	End	E-Value	Type
low complexity region	33	50	N/A	INTRINSIC
Cation_ATPase_N	51	125	1.22e-14	SMART
Pfam:E1-E2_ATPase	144	375	2.6e-59	PFAM
Pfam:Hydrolase	380	738	8.1e-19	PFAM
Pfam:HAD	383	735	1.6e-17	PFAM
Pfam:Cation_ATPase	437	531	9.2e-25	PFAM
Pfam:Cation_ATPase_C	808	1017	1.2e-47	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191616

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.8%
20x: 96.1%

Validation Efficiency

99% (99/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	T	A	3: 108,469,535	H509L	probably benign	Het
9930021J03Rik	T	A	19: 29,717,981	I1438F	probably benign	Het
Adam9	A	T	8: 24,996,758	I168N	probably benign	Het
Adamts20	G	A	15: 94,347,690	A577V	probably benign	Het
Agtr1a	A	T	13: 30,381,296	S115C	probably damaging	Het
Ankrd11	T	C	8: 122,891,953	Y1720C	probably damaging	Het
Ano6	A	T	15: 95,920,371	T353S	probably damaging	Het
App	A	G	16: 85,079,952	F184L	probably damaging	Het
Arhgef38	T	A	3: 133,137,471	Y446F	probably benign	Het
Aspg	T	A	12: 112,112,259	Y57*	probably null	Het
Bdp1	G	A	13: 100,058,951		probably benign	Het
Bicd2	T	A	13: 49,378,241	S246T	possibly damaging	Het
Bsn	T	A	9: 108,106,812	M3348L	unknown	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Cacna2d3	T	C	14: 28,982,365	I820V	probably benign	Het
Cdc40	A	G	10: 40,844,956		probably benign	Het
Cdh23	T	C	10: 60,323,714	E2094G	probably damaging	Het
Celsr2	T	A	3: 108,398,606	N2061Y	probably damaging	Het
Cfap206	G	A	4: 34,711,391	A502V	probably benign	Het
Cfap54	T	C	10: 93,034,737	T29A	probably benign	Het
Cfap57	T	C	4: 118,612,920		probably null	Het
Chd5	A	G	4: 152,347,984	E43G	possibly damaging	Het
Clk1	G	A	1: 58,414,399	H343Y	probably benign	Het
Cntn4	A	C	6: 106,550,486	K443T	probably damaging	Het
Csn2	G	A	5: 87,694,952	A72V	possibly damaging	Het
Ctdp1	T	A	18: 80,450,242	H346L	probably benign	Het
Ctif	A	T	18: 75,565,012	N192K	probably damaging	Het
Ddr2	G	A	1: 169,995,566	A383V	probably benign	Het
Derl3	C	T	10: 75,895,242		probably benign	Het
Dgkh	T	C	14: 78,584,479	I865V	probably damaging	Het
Dip2b	C	T	15: 100,171,651	A619V	probably damaging	Het
Eml1	A	G	12: 108,530,326	T614A	possibly damaging	Het
Eogt	G	C	6: 97,116,009	Y402*	probably null	Het
Erbb4	A	G	1: 68,259,290	V647A	probably damaging	Het
Esm1	G	T	13: 113,213,502		probably null	Het
Fbxo31	A	G	8: 121,555,364		probably benign	Het
Fbxw5	T	A	2: 25,504,618	D201E	possibly damaging	Het
Fgfr1	G	A	8: 25,555,744	D123N	probably benign	Het
G530012D18Rik	A	C	1: 85,577,036		probably benign	Het
Gnat1	G	A	9: 107,679,463	T29I	probably damaging	Het
Gtf2ird2	A	T	5: 134,192,758	R67*	probably null	Het
Iltifb	A	T	10: 118,294,237	D87E	probably benign	Het
Kcnq3	T	C	15: 65,995,608	T729A	probably benign	Het
Klrc2	A	T	6: 129,658,696	S156R	probably damaging	Het
Krt76	A	T	15: 101,887,349	L462Q	probably damaging	Het
Lama3	C	A	18: 12,456,850		probably benign	Het
Lin28a	A	T	4: 134,008,008	S56T	probably damaging	Het
Macf1	A	G	4: 123,382,530		probably benign	Het
Macrod2	C	T	2: 142,217,674		probably benign	Het
Mansc1	C	T	6: 134,617,461		probably benign	Het
Map1b	G	T	13: 99,429,766	S2149*	probably null	Het
Mgst1	A	T	6: 138,147,669	T34S	probably benign	Het
Mlf2	C	T	6: 124,934,391	T123M	probably damaging	Het
Mospd2	C	T	X: 164,948,257		probably benign	Het
Mrpl15	A	T	1: 4,777,611	V155E	probably damaging	Het
Mstn	A	T	1: 53,061,794	Y10F	possibly damaging	Het
Myo1g	C	T	11: 6,520,794	V21M	probably damaging	Het
Myom2	T	C	8: 15,099,326	I599T	probably benign	Het
Ndc80	A	T	17: 71,496,246	N633K	probably benign	Het
Nhs	C	A	X: 161,837,300	V1487L	possibly damaging	Het
Npc1	T	C	18: 12,219,325	T106A	probably benign	Het
Nup133	C	T	8: 123,949,008	V57M	probably benign	Het
Nup98	T	A	7: 102,160,716	T536S	probably damaging	Het
Olfr1045	A	G	2: 86,198,725	V9A	probably benign	Het
Olfr1106	T	C	2: 87,049,148	I29M	probably benign	Het
Olfr818	T	A	10: 129,945,111	H317L	probably benign	Het
Oprm1	T	C	10: 6,832,652		probably benign	Het
Ostf1	C	T	19: 18,604,207	V14I	unknown	Het
Pcdhb14	C	A	18: 37,448,868	D342E	probably damaging	Het
Pdia3	G	A	2: 121,432,377	G275S	probably damaging	Het
Pdpr	T	C	8: 111,125,755		probably null	Het
Plce1	G	A	19: 38,716,691	V847M	probably damaging	Het
Pon3	A	G	6: 5,230,444	M288T	probably benign	Het
Psd2	A	T	18: 35,978,574	D84V	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Ralgapa1	T	C	12: 55,665,663	K1808E	probably damaging	Het
Ramp3	T	C	11: 6,676,476		probably benign	Het
Rasgrf1	T	A	9: 89,951,009		probably benign	Het
Rictor	A	G	15: 6,773,986		probably benign	Het
Rptor	A	T	11: 119,884,954	I984F	probably benign	Het
Slc1a6	C	T	10: 78,796,008	P223S	probably benign	Het
Taar8b	A	C	10: 24,092,026	V90G	probably damaging	Het
Tbc1d21	A	G	9: 58,359,877	V327A	probably benign	Het
Tex21	T	C	12: 76,204,166	T499A	probably benign	Het
Tg	A	T	15: 66,678,789	D256V	probably damaging	Het
Tmf1	A	G	6: 97,176,492	S207P	probably benign	Het
Tpr	A	G	1: 150,393,407		probably benign	Het
Ufd1	A	G	16: 18,814,887	T21A	probably damaging	Het
Unc13a	T	C	8: 71,656,285	D115G	possibly damaging	Het
Usb1	T	A	8: 95,344,041	F198L	probably damaging	Het
Utrn	A	T	10: 12,698,158		probably benign	Het
Vars	A	G	17: 35,014,300	N954S	probably damaging	Het
Wdr17	C	T	8: 54,693,096	A90T	possibly damaging	Het
Wdr33	C	T	18: 31,835,376		probably benign	Het
Zfp236	A	G	18: 82,640,244		probably benign	Het
Zfp445	A	T	9: 122,861,758	V124E	probably damaging	Het
Zfp616	A	T	11: 74,084,822	H639L	probably damaging	Het
Zfyve16	C	A	13: 92,521,477	S642I	probably damaging	Het
Zswim5	C	T	4: 116,985,746	T896I	possibly damaging	Het

Other mutations in Atp1a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Atp1a4	APN	1	172239806	missense	probably damaging	1.00
IGL00924:Atp1a4	APN	1	172246772	missense	probably damaging	1.00
IGL01288:Atp1a4	APN	1	172257907	missense	possibly damaging	0.77
IGL01665:Atp1a4	APN	1	172246724	missense	probably benign
IGL02156:Atp1a4	APN	1	172257962	missense	probably benign
IGL02170:Atp1a4	APN	1	172234536	missense	possibly damaging	0.94
IGL02228:Atp1a4	APN	1	172254885	missense	possibly damaging	0.69
IGL02505:Atp1a4	APN	1	172235075	missense	probably damaging	1.00
IGL02653:Atp1a4	APN	1	172251406	missense	possibly damaging	0.81
IGL02792:Atp1a4	APN	1	172227299	critical splice donor site	probably null
IGL02794:Atp1a4	APN	1	172244086	missense	probably benign	0.13
IGL03102:Atp1a4	APN	1	172231151	missense	probably damaging	1.00
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0276:Atp1a4	UTSW	1	172257901	missense	probably damaging	1.00
R0309:Atp1a4	UTSW	1	172234987	missense	probably damaging	1.00
R0525:Atp1a4	UTSW	1	172239688	splice site	probably benign
R0615:Atp1a4	UTSW	1	172232060	splice site	probably benign
R1412:Atp1a4	UTSW	1	172232009	missense	probably damaging	0.97
R1652:Atp1a4	UTSW	1	172254903	missense	probably damaging	1.00
R1898:Atp1a4	UTSW	1	172235048	missense	probably damaging	0.99
R1968:Atp1a4	UTSW	1	172240164	missense	probably benign
R2291:Atp1a4	UTSW	1	172244906	missense	probably damaging	1.00
R2897:Atp1a4	UTSW	1	172246690	missense	probably damaging	1.00
R2908:Atp1a4	UTSW	1	172234477	missense	probably benign
R3119:Atp1a4	UTSW	1	172239826	missense	probably damaging	0.99
R3731:Atp1a4	UTSW	1	172233961	missense	probably damaging	1.00
R4447:Atp1a4	UTSW	1	172234431	missense	probably damaging	0.99
R4602:Atp1a4	UTSW	1	172239765	missense	probably damaging	1.00
R4670:Atp1a4	UTSW	1	172235000	missense	probably benign	0.07
R4674:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4675:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4785:Atp1a4	UTSW	1	172254110	nonsense	probably null
R4958:Atp1a4	UTSW	1	172231151	missense	probably damaging	1.00
R5015:Atp1a4	UTSW	1	172254082	missense	probably damaging	1.00
R5149:Atp1a4	UTSW	1	172232005	missense	probably damaging	1.00
R5234:Atp1a4	UTSW	1	172227170	missense	possibly damaging	0.73
R5501:Atp1a4	UTSW	1	172246832	missense	probably damaging	1.00
R5682:Atp1a4	UTSW	1	172254163	missense	probably damaging	0.99
R5872:Atp1a4	UTSW	1	172244408	missense	probably damaging	1.00
R5933:Atp1a4	UTSW	1	172232274	missense	possibly damaging	0.91
R6722:Atp1a4	UTSW	1	172258050	unclassified	probably benign
R7087:Atp1a4	UTSW	1	172246702	missense	probably damaging	1.00
R7122:Atp1a4	UTSW	1	172231936	missense	possibly damaging	0.47
R7381:Atp1a4	UTSW	1	172240115	missense	possibly damaging	0.70
R7431:Atp1a4	UTSW	1	172250907	missense	probably benign	0.31
R8269:Atp1a4	UTSW	1	172232325	missense	probably damaging	1.00
R8400:Atp1a4	UTSW	1	172234494	missense	probably damaging	1.00
R8559:Atp1a4	UTSW	1	172251330	missense	probably damaging	1.00
R8680:Atp1a4	UTSW	1	172250999	missense	probably damaging	1.00
R8777:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8777-TAIL:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
Z1176:Atp1a4	UTSW	1	172231954	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- AATGGTGTCCTTTCAAAGCCCTCTC -3'
(R):5'- TTCGCAAGATCAGGTGGACTTAGC -3'

Sequencing Primer
(F):5'- AGCACACGTTCGCCCAG -3'
(R):5'- AAAGAGTACCTGCTGTGCC -3'

Posted On

2013-09-03