Incidental Mutation 'R8840:Ccdc8'
ID 674366
Institutional Source Beutler Lab
Gene Symbol Ccdc8
Ensembl Gene ENSMUSG00000041117
Gene Name coiled-coil domain containing 8
Synonyms ENSMUSG00000041117
MMRRC Submission 068668-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8840 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 16727827-16731440 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 16728642 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 44 (F44I)
Ref Sequence ENSEMBL: ENSMUSP00000092399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094805]
AlphaFold D3YZV8
Predicted Effect probably damaging
Transcript: ENSMUST00000094805
AA Change: F44I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092399
Gene: ENSMUSG00000041117
AA Change: F44I

DomainStartEndE-ValueType
Pfam:PNMA 1 98 1.3e-19 PFAM
low complexity region 166 171 N/A INTRINSIC
internal_repeat_1 207 275 5.53e-5 PROSPERO
low complexity region 297 332 N/A INTRINSIC
low complexity region 335 420 N/A INTRINSIC
low complexity region 430 452 N/A INTRINSIC
low complexity region 458 468 N/A INTRINSIC
low complexity region 478 540 N/A INTRINSIC
internal_repeat_1 566 640 5.53e-5 PROSPERO
low complexity region 646 658 N/A INTRINSIC
Meta Mutation Damage Score 0.4319 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein functions as a cofactor required for p53-mediated apoptosis following DNA damage, and may also play a role in growth through interactions with the cytoskeletal adaptor protein obscurin-like 1. Mutations in this gene are a cause of 3M syndrome-3 (3M3). [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc4 G A 5: 53,016,473 (GRCm39) D484N probably damaging Het
Antxr2 T A 5: 98,152,769 (GRCm39) L109F probably damaging Het
Arhgap9 A G 10: 127,161,009 (GRCm39) T179A possibly damaging Het
Atp6v1b1 A T 6: 83,733,845 (GRCm39) I359F Het
Btnl1 A G 17: 34,604,577 (GRCm39) T453A probably benign Het
Bub1 T C 2: 127,649,927 (GRCm39) I644V probably benign Het
Ccdc163 T A 4: 116,567,483 (GRCm39) probably null Het
Ccz1 T C 5: 143,940,982 (GRCm39) I191V probably damaging Het
Cldn1 T C 16: 26,190,286 (GRCm39) K31E possibly damaging Het
Ctr9 A G 7: 110,642,237 (GRCm39) D321G probably damaging Het
Dmxl2 T C 9: 54,309,139 (GRCm39) N1871D possibly damaging Het
Dop1b A G 16: 93,607,005 (GRCm39) I2103V probably benign Het
Dscaml1 A G 9: 45,634,718 (GRCm39) E1211G probably damaging Het
Eppk1 T A 15: 75,994,094 (GRCm39) D929V probably benign Het
Fam151a T C 4: 106,602,819 (GRCm39) V246A probably benign Het
Fsip2 A G 2: 82,821,606 (GRCm39) I5780V probably benign Het
Gart A T 16: 91,433,010 (GRCm39) M313K probably benign Het
Gnl1 T G 17: 36,293,486 (GRCm39) L224V probably damaging Het
Hectd3 T C 4: 116,855,604 (GRCm39) V368A probably benign Het
Ibsp C T 5: 104,458,006 (GRCm39) A181V probably benign Het
Kdm1a T C 4: 136,287,716 (GRCm39) E421G probably damaging Het
Kmt2a A T 9: 44,721,016 (GRCm39) Y3831N unknown Het
Meltf T C 16: 31,716,020 (GRCm39) L733P probably damaging Het
Nod2 T C 8: 89,399,379 (GRCm39) F898L probably benign Het
Npr3 A T 15: 11,905,329 (GRCm39) Y133N probably damaging Het
Or8g29-ps1 G A 9: 39,201,018 (GRCm39) T56I unknown Het
Pkd1l3 T C 8: 110,349,842 (GRCm39) V229A unknown Het
Pramel25 C A 4: 143,521,638 (GRCm39) T418K probably damaging Het
Primpol A T 8: 47,046,731 (GRCm39) F188L probably damaging Het
Rbm15 A G 3: 107,240,305 (GRCm39) V31A probably benign Het
Robo2 T A 16: 73,782,570 (GRCm39) D322V probably damaging Het
Rpl3l A G 17: 24,952,711 (GRCm39) N114S probably damaging Het
Sacs A G 14: 61,429,177 (GRCm39) D412G probably benign Het
Sbno2 A G 10: 79,893,360 (GRCm39) S1314P probably damaging Het
Sez6 A G 11: 77,867,313 (GRCm39) D770G probably damaging Het
Skint7 T C 4: 111,845,183 (GRCm39) F332L probably benign Het
Spaca6 A T 17: 18,051,365 (GRCm39) I34F possibly damaging Het
Suclg2 T A 6: 95,546,615 (GRCm39) E287V probably damaging Het
Trhr2 T C 8: 123,085,621 (GRCm39) Y121C probably damaging Het
Ttn T G 2: 76,606,371 (GRCm39) D18146A probably damaging Het
Wdr3 G A 3: 100,057,253 (GRCm39) T450I probably damaging Het
Xab2 A G 8: 3,663,254 (GRCm39) F470L probably benign Het
Ythdc2 A G 18: 44,993,691 (GRCm39) H912R probably damaging Het
Zfp64 A T 2: 168,768,635 (GRCm39) S326T probably benign Het
Zswim4 C T 8: 84,940,699 (GRCm39) R800Q probably damaging Het
Other mutations in Ccdc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Ccdc8 APN 7 16,729,967 (GRCm39) missense unknown
R0255:Ccdc8 UTSW 7 16,729,582 (GRCm39) missense unknown
R0504:Ccdc8 UTSW 7 16,729,939 (GRCm39) missense unknown
R3843:Ccdc8 UTSW 7 16,729,039 (GRCm39) missense probably damaging 1.00
R5054:Ccdc8 UTSW 7 16,728,970 (GRCm39) missense probably damaging 1.00
R6020:Ccdc8 UTSW 7 16,730,506 (GRCm39) missense probably damaging 0.99
R6045:Ccdc8 UTSW 7 16,729,956 (GRCm39) missense unknown
R6244:Ccdc8 UTSW 7 16,730,176 (GRCm39) missense probably benign 0.04
R6753:Ccdc8 UTSW 7 16,730,562 (GRCm39) nonsense probably null
R7299:Ccdc8 UTSW 7 16,729,956 (GRCm39) missense unknown
R7567:Ccdc8 UTSW 7 16,728,687 (GRCm39) missense probably damaging 1.00
R7623:Ccdc8 UTSW 7 16,730,537 (GRCm39) missense possibly damaging 0.70
R7745:Ccdc8 UTSW 7 16,729,614 (GRCm39) missense unknown
R8310:Ccdc8 UTSW 7 16,729,326 (GRCm39) missense probably damaging 1.00
R8707:Ccdc8 UTSW 7 16,729,975 (GRCm39) missense unknown
R9099:Ccdc8 UTSW 7 16,728,800 (GRCm39) nonsense probably null
R9630:Ccdc8 UTSW 7 16,728,733 (GRCm39) missense possibly damaging 0.91
R9696:Ccdc8 UTSW 7 16,730,087 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AAAGATGTCGATCTGGACGTG -3'
(R):5'- TTGCTGCTGTCATAGGTACC -3'

Sequencing Primer
(F):5'- CCTTTAAGAAAATCGGAAAGGTGTTC -3'
(R):5'- GCTGCTGTCATAGGTACCTACAAC -3'
Posted On 2021-07-15