Incidental Mutation 'R8841:Smok3c'
ID 674409
Institutional Source Beutler Lab
Gene Symbol Smok3c
Ensembl Gene ENSMUSG00000075598
Gene Name sperm motility kinase 3C
Synonyms EG622486
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.534) question?
Stock # R8841 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 138053194-138066537 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 138065275 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 341 (D341E)
Ref Sequence ENSEMBL: ENSMUSP00000141020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110967] [ENSMUST00000178402]
AlphaFold A0A087WSF2
Predicted Effect probably damaging
Transcript: ENSMUST00000110967
AA Change: D341E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141020
Gene: ENSMUSG00000075598
AA Change: D341E

DomainStartEndE-ValueType
S_TKc 28 276 2.88e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178402
AA Change: D341E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140749
Gene: ENSMUSG00000075598
AA Change: D341E

DomainStartEndE-ValueType
S_TKc 28 276 2.88e-97 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 C T 4: 53,143,925 probably benign Het
Chaf1b C T 16: 93,905,020 T510I probably benign Het
Chrd T A 16: 20,735,737 probably benign Het
Dennd2d A G 3: 106,486,264 Q11R probably benign Het
Dmrta1 A C 4: 89,691,713 R303S probably benign Het
Emsy A G 7: 98,615,561 I543T possibly damaging Het
Fam198b A G 3: 79,887,119 E298G probably benign Het
Fbxw2 G A 2: 34,822,832 probably benign Het
Fndc1 A G 17: 7,773,349 V505A unknown Het
Foxf1 T C 8: 121,085,180 V261A probably damaging Het
Fyb T C 15: 6,652,491 V773A probably damaging Het
Glp2r G T 11: 67,762,729 P77T probably damaging Het
Gpam C A 19: 55,078,518 D522Y probably damaging Het
Hpgd T A 8: 56,307,674 N135K probably damaging Het
Hsph1 T A 5: 149,627,324 R437W probably damaging Het
Kif1c G A 11: 70,724,833 V588I probably benign Het
Klhdc4 T A 8: 121,796,641 E554V possibly damaging Het
Krt33a A G 11: 100,014,135 S182P probably damaging Het
Lad1 A G 1: 135,827,232 D82G probably benign Het
Lin7a A G 10: 107,382,663 R145G possibly damaging Het
Lmna A G 3: 88,484,613 probably null Het
Lrrc8b T C 5: 105,480,322 V178A probably benign Het
Lrwd1 T C 5: 136,123,183 R647G possibly damaging Het
Mapt A G 11: 104,310,377 E153G probably damaging Het
Mefv C T 16: 3,710,978 C563Y probably benign Het
Myo7b T C 18: 31,964,437 N1792S probably benign Het
Nkx6-3 C T 8: 23,156,258 T148M probably damaging Het
Nomo1 T A 7: 46,058,487 S573T probably benign Het
Ntrk3 G T 7: 78,356,093 R507S probably damaging Het
Olfr1396 A C 11: 49,113,111 I205S probably benign Het
Olfr678 T A 7: 105,070,272 N268K possibly damaging Het
Olfr727 T A 14: 50,127,209 F211I probably damaging Het
Olfr764-ps1 A G 10: 129,034,173 V223A probably benign Het
Olfr859 A T 9: 19,808,589 R90S probably benign Het
Olfr935 A G 9: 38,994,583 M284T possibly damaging Het
Pcdhb8 A G 18: 37,355,646 I126V probably benign Het
Phactr4 A G 4: 132,365,573 probably null Het
Pign T C 1: 105,557,909 probably benign Het
Plekhn1 A G 4: 156,232,198 L342P probably damaging Het
Pomk G A 8: 25,986,379 A49V probably benign Het
Prss50 A G 9: 110,858,412 D141G probably benign Het
Ralgps1 A C 2: 33,155,317 F406L probably benign Het
Rexo5 G A 7: 119,848,788 S752N probably benign Het
Rin3 A T 12: 102,369,278 I483L probably benign Het
Scn1a T A 2: 66,326,122 D481V probably benign Het
Scnn1a T C 6: 125,343,245 I554T probably damaging Het
Shc2 A G 10: 79,622,316 V511A probably damaging Het
Slc18a2 C T 19: 59,273,281 S200F probably damaging Het
Slc25a38 A G 9: 120,120,779 D208G probably damaging Het
Tfcp2 A G 15: 100,513,108 I373T probably damaging Het
Tnpo3 T A 6: 29,589,183 D56V probably damaging Het
Trrap T A 5: 144,844,211 Y3261N probably damaging Het
Ttll12 A T 15: 83,581,792 probably benign Het
Ulk4 A G 9: 121,204,738 C612R probably damaging Het
Ush1g G T 11: 115,319,181 D62E probably damaging Het
Vmn2r124 A G 17: 18,063,037 N331S Het
Vmn2r4 T C 3: 64,406,637 I308V probably damaging Het
Vwa8 T A 14: 78,947,262 V400E probably benign Het
Washc2 A G 6: 116,258,955 D1129G probably benign Het
Washc5 G T 15: 59,335,122 Q1101K probably damaging Het
Wfdc17 G T 11: 83,704,112 L7F probably benign Het
Xpo4 T C 14: 57,597,956 K636R probably damaging Het
Zan T A 5: 137,456,674 T1367S unknown Het
Zfp691 A T 4: 119,170,664 S124T probably damaging Het
Other mutations in Smok3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4440:Smok3c UTSW 5 138064604 missense possibly damaging 0.93
R4560:Smok3c UTSW 5 138064484 missense probably benign 0.42
R4900:Smok3c UTSW 5 138064551 missense probably damaging 1.00
R4924:Smok3c UTSW 5 138065582 nonsense probably null
R5292:Smok3c UTSW 5 138065184 missense probably damaging 1.00
R5446:Smok3c UTSW 5 138064633 missense probably damaging 1.00
R6111:Smok3c UTSW 5 138065103 missense probably damaging 0.98
R6154:Smok3c UTSW 5 138064485 missense probably benign 0.04
R6225:Smok3c UTSW 5 138065052 missense probably benign 0.15
R6759:Smok3c UTSW 5 138065437 missense probably benign 0.04
R6979:Smok3c UTSW 5 138064725 missense probably benign 0.12
R7127:Smok3c UTSW 5 138064709 missense probably damaging 0.96
R7260:Smok3c UTSW 5 138065623 missense possibly damaging 0.84
R7445:Smok3c UTSW 5 138064495 missense probably damaging 1.00
R7962:Smok3c UTSW 5 138065079 missense probably damaging 0.98
R8160:Smok3c UTSW 5 138065024 missense possibly damaging 0.91
R8223:Smok3c UTSW 5 138065393 missense probably benign 0.00
R8381:Smok3c UTSW 5 138065562 missense probably benign
R9166:Smok3c UTSW 5 138065519 missense possibly damaging 0.61
R9369:Smok3c UTSW 5 138065508 missense probably damaging 0.98
Z1177:Smok3c UTSW 5 138064602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAGGTTATGGTGCATCC -3'
(R):5'- TGGGCCAACTGACTCTTCTG -3'

Sequencing Primer
(F):5'- TATGGTGCATCCCTGGGTCAC -3'
(R):5'- GCCAACTGACTCTTCTGTCTCTTTTC -3'
Posted On 2021-07-15