Incidental Mutation 'R8841:Klhdc4'
ID674424
Institutional Source Beutler Lab
Gene Symbol Klhdc4
Ensembl Gene ENSMUSG00000040263
Gene Namekelch domain containing 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R8841 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location121796313-121829569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121796641 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 554 (E554V)
Ref Sequence ENSEMBL: ENSMUSP00000043439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045884] [ENSMUST00000127664] [ENSMUST00000167439] [ENSMUST00000174192] [ENSMUST00000174665] [ENSMUST00000174717]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045884
AA Change: E554V

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000043439
Gene: ENSMUSG00000040263
AA Change: E554V

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
Pfam:Kelch_4 63 118 8.3e-11 PFAM
Pfam:Kelch_3 75 125 1.7e-9 PFAM
Pfam:Kelch_6 118 174 2.4e-9 PFAM
Pfam:Kelch_4 118 175 3e-8 PFAM
Pfam:Kelch_3 131 185 2e-8 PFAM
Pfam:Kelch_5 173 216 7.5e-9 PFAM
Pfam:Kelch_3 186 239 2.1e-6 PFAM
Pfam:Kelch_1 295 345 4.6e-6 PFAM
Pfam:Kelch_2 295 349 2.1e-7 PFAM
low complexity region 489 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167439
SMART Domains Protein: ENSMUSP00000126190
Gene: ENSMUSG00000025318

DomainStartEndE-ValueType
MORN 13 34 8.01e-1 SMART
MORN 37 57 6.13e1 SMART
MORN 59 80 2.99e-1 SMART
Pfam:MORN 83 104 5.8e-2 PFAM
MORN 105 126 8.1e-5 SMART
MORN 128 149 2.74e-2 SMART
low complexity region 181 192 N/A INTRINSIC
low complexity region 212 244 N/A INTRINSIC
MORN 286 307 2.78e-3 SMART
MORN 309 330 1.03e-6 SMART
low complexity region 360 381 N/A INTRINSIC
low complexity region 393 409 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
transmembrane domain 721 743 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174192
AA Change: E497V

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134487
Gene: ENSMUSG00000040263
AA Change: E497V

DomainStartEndE-ValueType
Pfam:Kelch_3 32 70 1.5e-6 PFAM
Pfam:Kelch_6 61 117 1.9e-8 PFAM
Pfam:Kelch_4 61 118 6.9e-8 PFAM
Pfam:Kelch_3 74 128 4.6e-8 PFAM
Pfam:Kelch_5 116 159 1.4e-7 PFAM
Pfam:Kelch_4 119 172 2.2e-6 PFAM
Pfam:Kelch_3 129 182 7e-7 PFAM
Pfam:Kelch_2 238 292 1.8e-7 PFAM
low complexity region 432 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174665
SMART Domains Protein: ENSMUSP00000134474
Gene: ENSMUSG00000040263

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 57 67 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174717
AA Change: E523V

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134361
Gene: ENSMUSG00000040263
AA Change: E523V

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
Pfam:Kelch_4 63 117 1.4e-8 PFAM
Pfam:Kelch_3 75 127 9.6e-11 PFAM
Pfam:Kelch_4 118 170 2.3e-7 PFAM
Pfam:Kelch_6 118 174 9.3e-9 PFAM
low complexity region 191 202 N/A INTRINSIC
Pfam:Kelch_2 264 318 2e-7 PFAM
low complexity region 458 489 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Chaf1b C T 16: 93,905,020 T510I probably benign Het
Dennd2d A G 3: 106,486,264 Q11R probably benign Het
Dmrta1 A C 4: 89,691,713 R303S probably benign Het
Emsy A G 7: 98,615,561 I543T possibly damaging Het
Fam198b A G 3: 79,887,119 E298G probably benign Het
Fbxw2 G A 2: 34,822,832 probably benign Het
Fndc1 A G 17: 7,773,349 V505A unknown Het
Foxf1 T C 8: 121,085,180 V261A probably damaging Het
Fyb T C 15: 6,652,491 V773A probably damaging Het
Glp2r G T 11: 67,762,729 P77T probably damaging Het
Gpam C A 19: 55,078,518 D522Y probably damaging Het
Hpgd T A 8: 56,307,674 N135K probably damaging Het
Hsph1 T A 5: 149,627,324 R437W probably damaging Het
Kif1c G A 11: 70,724,833 V588I probably benign Het
Krt33a A G 11: 100,014,135 S182P probably damaging Het
Lad1 A G 1: 135,827,232 D82G probably benign Het
Lin7a A G 10: 107,382,663 R145G possibly damaging Het
Lmna A G 3: 88,484,613 probably null Het
Lrrc8b T C 5: 105,480,322 V178A probably benign Het
Lrwd1 T C 5: 136,123,183 R647G possibly damaging Het
Mapt A G 11: 104,310,377 E153G probably damaging Het
Mefv C T 16: 3,710,978 C563Y probably benign Het
Myo7b T C 18: 31,964,437 N1792S probably benign Het
Nkx6-3 C T 8: 23,156,258 T148M probably damaging Het
Nomo1 T A 7: 46,058,487 S573T probably benign Het
Ntrk3 G T 7: 78,356,093 R507S probably damaging Het
Olfr1396 A C 11: 49,113,111 I205S probably benign Het
Olfr678 T A 7: 105,070,272 N268K possibly damaging Het
Olfr727 T A 14: 50,127,209 F211I probably damaging Het
Olfr764-ps1 A G 10: 129,034,173 V223A probably benign Het
Olfr859 A T 9: 19,808,589 R90S probably benign Het
Olfr935 A G 9: 38,994,583 M284T possibly damaging Het
Pcdhb8 A G 18: 37,355,646 I126V probably benign Het
Phactr4 A G 4: 132,365,573 probably null Het
Plekhn1 A G 4: 156,232,198 L342P probably damaging Het
Pomk G A 8: 25,986,379 A49V probably benign Het
Prss50 A G 9: 110,858,412 D141G probably benign Het
Ralgps1 A C 2: 33,155,317 F406L probably benign Het
Rexo5 G A 7: 119,848,788 S752N probably benign Het
Rin3 A T 12: 102,369,278 I483L probably benign Het
Scn1a T A 2: 66,326,122 D481V probably benign Het
Scnn1a T C 6: 125,343,245 I554T probably damaging Het
Shc2 A G 10: 79,622,316 V511A probably damaging Het
Slc18a2 C T 19: 59,273,281 S200F probably damaging Het
Slc25a38 A G 9: 120,120,779 D208G probably damaging Het
Smok3c C A 5: 138,065,275 D341E probably damaging Het
Tfcp2 A G 15: 100,513,108 I373T probably damaging Het
Tnpo3 T A 6: 29,589,183 D56V probably damaging Het
Trrap T A 5: 144,844,211 Y3261N probably damaging Het
Ulk4 A G 9: 121,204,738 C612R probably damaging Het
Ush1g G T 11: 115,319,181 D62E probably damaging Het
Vmn2r124 A G 17: 18,063,037 N331S Het
Vmn2r4 T C 3: 64,406,637 I308V probably damaging Het
Vwa8 T A 14: 78,947,262 V400E probably benign Het
Washc2 A G 6: 116,258,955 D1129G probably benign Het
Washc5 G T 15: 59,335,122 Q1101K probably damaging Het
Wfdc17 G T 11: 83,704,112 L7F probably benign Het
Xpo4 T C 14: 57,597,956 K636R probably damaging Het
Zan T A 5: 137,456,674 T1367S unknown Het
Zfp691 A T 4: 119,170,664 S124T probably damaging Het
Other mutations in Klhdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Klhdc4 APN 8 121821843 nonsense probably null
IGL01678:Klhdc4 APN 8 121796938 missense possibly damaging 0.73
kilimanjaro UTSW 8 121813790 nonsense probably null
R0577:Klhdc4 UTSW 8 121821351 missense probably damaging 0.99
R0881:Klhdc4 UTSW 8 121799487 nonsense probably null
R1710:Klhdc4 UTSW 8 121799487 nonsense probably null
R2993:Klhdc4 UTSW 8 121806581 nonsense probably null
R3028:Klhdc4 UTSW 8 121799549 missense probably damaging 1.00
R3109:Klhdc4 UTSW 8 121821334 missense probably damaging 1.00
R3711:Klhdc4 UTSW 8 121798055 missense probably benign
R4132:Klhdc4 UTSW 8 121798065 missense possibly damaging 0.79
R4601:Klhdc4 UTSW 8 121799527 missense probably damaging 1.00
R4644:Klhdc4 UTSW 8 121822000 intron probably benign
R4758:Klhdc4 UTSW 8 121798044 missense probably benign 0.00
R4999:Klhdc4 UTSW 8 121796603 missense probably benign 0.00
R5177:Klhdc4 UTSW 8 121813790 nonsense probably null
R5364:Klhdc4 UTSW 8 121806636 intron probably benign
R5475:Klhdc4 UTSW 8 121799572 missense possibly damaging 0.67
R5705:Klhdc4 UTSW 8 121804993 missense probably benign 0.01
R6248:Klhdc4 UTSW 8 121813768 missense probably damaging 1.00
R6326:Klhdc4 UTSW 8 121805054 missense probably damaging 1.00
R6626:Klhdc4 UTSW 8 121820162 missense probably benign 0.43
R7274:Klhdc4 UTSW 8 121799658 critical splice acceptor site probably null
R7716:Klhdc4 UTSW 8 121829420 missense unknown
R8430:Klhdc4 UTSW 8 121799513 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGCCACTGTGAAGTCAGGCTAG -3'
(R):5'- GTTGCCATTCAGTGTACCCC -3'

Sequencing Primer
(F):5'- TAGCCCCCGTCAGACTGTG -3'
(R):5'- ATTCAGTGTACCCCCGCCC -3'
Posted On2021-07-15