Incidental Mutation 'R8841:Ulk4'
ID 674429
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Name unc-51-like kinase 4
Synonyms 4932415A06Rik
Accession Numbers

Genbank: NM_177589; MGI: 1921622

Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock # R8841 (G1)
Quality Score 206.009
Status Validated
Chromosome 9
Chromosomal Location 120955351-121277197 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121204738 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 612 (C612R)
Ref Sequence ENSEMBL: ENSMUSP00000057960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000170237] [ENSMUST00000171061] [ENSMUST00000171923]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000051479
AA Change: C612R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: C612R

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000170237
Predicted Effect probably damaging
Transcript: ENSMUST00000171061
AA Change: C612R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936
AA Change: C612R

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171923
AA Change: C612R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: C612R

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 C T 4: 53,143,925 probably benign Het
Chaf1b C T 16: 93,905,020 T510I probably benign Het
Chrd T A 16: 20,735,737 probably benign Het
Dennd2d A G 3: 106,486,264 Q11R probably benign Het
Dmrta1 A C 4: 89,691,713 R303S probably benign Het
Emsy A G 7: 98,615,561 I543T possibly damaging Het
Fam198b A G 3: 79,887,119 E298G probably benign Het
Fbxw2 G A 2: 34,822,832 probably benign Het
Fndc1 A G 17: 7,773,349 V505A unknown Het
Foxf1 T C 8: 121,085,180 V261A probably damaging Het
Fyb T C 15: 6,652,491 V773A probably damaging Het
Glp2r G T 11: 67,762,729 P77T probably damaging Het
Gpam C A 19: 55,078,518 D522Y probably damaging Het
Hpgd T A 8: 56,307,674 N135K probably damaging Het
Hsph1 T A 5: 149,627,324 R437W probably damaging Het
Kif1c G A 11: 70,724,833 V588I probably benign Het
Klhdc4 T A 8: 121,796,641 E554V possibly damaging Het
Krt33a A G 11: 100,014,135 S182P probably damaging Het
Lad1 A G 1: 135,827,232 D82G probably benign Het
Lin7a A G 10: 107,382,663 R145G possibly damaging Het
Lmna A G 3: 88,484,613 probably null Het
Lrrc8b T C 5: 105,480,322 V178A probably benign Het
Lrwd1 T C 5: 136,123,183 R647G possibly damaging Het
Mapt A G 11: 104,310,377 E153G probably damaging Het
Mefv C T 16: 3,710,978 C563Y probably benign Het
Myo7b T C 18: 31,964,437 N1792S probably benign Het
Nkx6-3 C T 8: 23,156,258 T148M probably damaging Het
Nomo1 T A 7: 46,058,487 S573T probably benign Het
Ntrk3 G T 7: 78,356,093 R507S probably damaging Het
Olfr1396 A C 11: 49,113,111 I205S probably benign Het
Olfr678 T A 7: 105,070,272 N268K possibly damaging Het
Olfr727 T A 14: 50,127,209 F211I probably damaging Het
Olfr764-ps1 A G 10: 129,034,173 V223A probably benign Het
Olfr859 A T 9: 19,808,589 R90S probably benign Het
Olfr935 A G 9: 38,994,583 M284T possibly damaging Het
Pcdhb8 A G 18: 37,355,646 I126V probably benign Het
Phactr4 A G 4: 132,365,573 probably null Het
Pign T C 1: 105,557,909 probably benign Het
Plekhn1 A G 4: 156,232,198 L342P probably damaging Het
Pomk G A 8: 25,986,379 A49V probably benign Het
Prss50 A G 9: 110,858,412 D141G probably benign Het
Ralgps1 A C 2: 33,155,317 F406L probably benign Het
Rexo5 G A 7: 119,848,788 S752N probably benign Het
Rin3 A T 12: 102,369,278 I483L probably benign Het
Scn1a T A 2: 66,326,122 D481V probably benign Het
Scnn1a T C 6: 125,343,245 I554T probably damaging Het
Shc2 A G 10: 79,622,316 V511A probably damaging Het
Slc18a2 C T 19: 59,273,281 S200F probably damaging Het
Slc25a38 A G 9: 120,120,779 D208G probably damaging Het
Smok3c C A 5: 138,065,275 D341E probably damaging Het
Tfcp2 A G 15: 100,513,108 I373T probably damaging Het
Tnpo3 T A 6: 29,589,183 D56V probably damaging Het
Trrap T A 5: 144,844,211 Y3261N probably damaging Het
Ttll12 A T 15: 83,581,792 probably benign Het
Ush1g G T 11: 115,319,181 D62E probably damaging Het
Vmn2r124 A G 17: 18,063,037 N331S Het
Vmn2r4 T C 3: 64,406,637 I308V probably damaging Het
Vwa8 T A 14: 78,947,262 V400E probably benign Het
Washc2 A G 6: 116,258,955 D1129G probably benign Het
Washc5 G T 15: 59,335,122 Q1101K probably damaging Het
Wfdc17 G T 11: 83,704,112 L7F probably benign Het
Xpo4 T C 14: 57,597,956 K636R probably damaging Het
Zan T A 5: 137,456,674 T1367S unknown Het
Zfp691 A T 4: 119,170,664 S124T probably damaging Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 121168292 missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121208162 missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121266301 missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121255185 missense probably damaging 1.00
IGL02139:Ulk4 APN 9 121141831 splice site probably null
IGL02266:Ulk4 APN 9 121081700 missense probably benign 0.10
IGL02511:Ulk4 APN 9 121188354 missense probably damaging 1.00
IGL02546:Ulk4 APN 9 121152307 nonsense probably null
IGL02687:Ulk4 APN 9 121192662 missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 121145336 missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121255171 missense probably benign 0.02
R0031:Ulk4 UTSW 9 121272982 missense probably damaging 1.00
R0433:Ulk4 UTSW 9 121044819 missense probably benign 0.27
R0513:Ulk4 UTSW 9 121152325 missense probably benign 0.13
R0524:Ulk4 UTSW 9 121252651 critical splice donor site probably null
R1268:Ulk4 UTSW 9 121257074 splice site probably benign
R1439:Ulk4 UTSW 9 121266258 missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1531:Ulk4 UTSW 9 121044775 missense probably damaging 0.97
R1595:Ulk4 UTSW 9 121044838 missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121204805 missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 121168184 missense probably null 1.00
R1966:Ulk4 UTSW 9 121257116 missense probably benign
R2129:Ulk4 UTSW 9 121152182 missense probably benign 0.03
R2329:Ulk4 UTSW 9 121272887 missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R2878:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R3734:Ulk4 UTSW 9 121261989 missense probably benign 0.21
R3769:Ulk4 UTSW 9 121263700 missense probably benign 0.00
R4005:Ulk4 UTSW 9 121168199 missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 121044849 missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 121073996 missense probably benign 0.00
R4461:Ulk4 UTSW 9 121156884 missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121263638 nonsense probably null
R4542:Ulk4 UTSW 9 121263638 nonsense probably null
R4572:Ulk4 UTSW 9 121192764 missense probably damaging 1.00
R4647:Ulk4 UTSW 9 121141852 missense probably benign 0.15
R4712:Ulk4 UTSW 9 121244370 missense probably benign 0.23
R4730:Ulk4 UTSW 9 121263725 missense probably benign 0.05
R4731:Ulk4 UTSW 9 121263638 nonsense probably null
R4732:Ulk4 UTSW 9 121263638 nonsense probably null
R4733:Ulk4 UTSW 9 121263638 nonsense probably null
R4737:Ulk4 UTSW 9 121073872 nonsense probably null
R4781:Ulk4 UTSW 9 121103576 missense probably benign 0.00
R4860:Ulk4 UTSW 9 121250902 missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121258732 missense probably benign 0.00
R4990:Ulk4 UTSW 9 121192786 missense probably benign 0.01
R6056:Ulk4 UTSW 9 121272955 missense probably damaging 1.00
R6448:Ulk4 UTSW 9 121103630 missense probably damaging 0.99
R6546:Ulk4 UTSW 9 121141894 missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121188342 missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121258820 missense probably benign
R6929:Ulk4 UTSW 9 121074015 missense probably benign 0.02
R7069:Ulk4 UTSW 9 121258810 missense probably benign 0.01
R7069:Ulk4 UTSW 9 121266517 missense probably benign 0.25
R7293:Ulk4 UTSW 9 121255124 missense probably damaging 1.00
R7299:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7301:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7337:Ulk4 UTSW 9 121248927 missense probably benign 0.44
R7395:Ulk4 UTSW 9 121255112 missense probably benign
R7423:Ulk4 UTSW 9 121103621 missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 121141838 missense probably benign 0.00
R7753:Ulk4 UTSW 9 121266512 critical splice donor site probably null
R7790:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 121044819 missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121272956 missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121266251 missense probably damaging 0.99
R8203:Ulk4 UTSW 9 121168208 missense probably damaging 0.96
R8246:Ulk4 UTSW 9 121156875 makesense probably null
R8430:Ulk4 UTSW 9 121257078 critical splice donor site probably null
R9014:Ulk4 UTSW 9 121188228 missense probably benign 0.00
R9092:Ulk4 UTSW 9 121073937 missense
R9126:Ulk4 UTSW 9 121261922 missense probably damaging 0.99
R9176:Ulk4 UTSW 9 121145062 missense probably benign
R9235:Ulk4 UTSW 9 121152151 missense probably benign 0.13
X0024:Ulk4 UTSW 9 121192753 missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121262606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCACACTGTTCACATTTC -3'
(R):5'- CGAGACCTGGAAAGCTTCAG -3'

Sequencing Primer
(F):5'- TTCCCAACATCTTTTAAACCAGGCG -3'
(R):5'- ACCTGGAAAGCTTCAGATGTTGTC -3'
Posted On 2021-07-15