Incidental Mutation 'R8841:Myo7b'
ID674451
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Namemyosin VIIB
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8841 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location31959234-32036961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31964437 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1792 (N1792S)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
Predicted Effect probably benign
Transcript: ENSMUST00000134663
AA Change: N1792S

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: N1792S

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Chaf1b C T 16: 93,905,020 T510I probably benign Het
Dennd2d A G 3: 106,486,264 Q11R probably benign Het
Dmrta1 A C 4: 89,691,713 R303S probably benign Het
Emsy A G 7: 98,615,561 I543T possibly damaging Het
Fam198b A G 3: 79,887,119 E298G probably benign Het
Fbxw2 G A 2: 34,822,832 probably benign Het
Fndc1 A G 17: 7,773,349 V505A unknown Het
Foxf1 T C 8: 121,085,180 V261A probably damaging Het
Fyb T C 15: 6,652,491 V773A probably damaging Het
Glp2r G T 11: 67,762,729 P77T probably damaging Het
Gpam C A 19: 55,078,518 D522Y probably damaging Het
Hpgd T A 8: 56,307,674 N135K probably damaging Het
Hsph1 T A 5: 149,627,324 R437W probably damaging Het
Kif1c G A 11: 70,724,833 V588I probably benign Het
Klhdc4 T A 8: 121,796,641 E554V possibly damaging Het
Krt33a A G 11: 100,014,135 S182P probably damaging Het
Lad1 A G 1: 135,827,232 D82G probably benign Het
Lin7a A G 10: 107,382,663 R145G possibly damaging Het
Lmna A G 3: 88,484,613 probably null Het
Lrrc8b T C 5: 105,480,322 V178A probably benign Het
Lrwd1 T C 5: 136,123,183 R647G possibly damaging Het
Mapt A G 11: 104,310,377 E153G probably damaging Het
Mefv C T 16: 3,710,978 C563Y probably benign Het
Nkx6-3 C T 8: 23,156,258 T148M probably damaging Het
Nomo1 T A 7: 46,058,487 S573T probably benign Het
Ntrk3 G T 7: 78,356,093 R507S probably damaging Het
Olfr1396 A C 11: 49,113,111 I205S probably benign Het
Olfr678 T A 7: 105,070,272 N268K possibly damaging Het
Olfr727 T A 14: 50,127,209 F211I probably damaging Het
Olfr764-ps1 A G 10: 129,034,173 V223A probably benign Het
Olfr859 A T 9: 19,808,589 R90S probably benign Het
Olfr935 A G 9: 38,994,583 M284T possibly damaging Het
Pcdhb8 A G 18: 37,355,646 I126V probably benign Het
Phactr4 A G 4: 132,365,573 probably null Het
Plekhn1 A G 4: 156,232,198 L342P probably damaging Het
Pomk G A 8: 25,986,379 A49V probably benign Het
Prss50 A G 9: 110,858,412 D141G probably benign Het
Ralgps1 A C 2: 33,155,317 F406L probably benign Het
Rexo5 G A 7: 119,848,788 S752N probably benign Het
Rin3 A T 12: 102,369,278 I483L probably benign Het
Scn1a T A 2: 66,326,122 D481V probably benign Het
Scnn1a T C 6: 125,343,245 I554T probably damaging Het
Shc2 A G 10: 79,622,316 V511A probably damaging Het
Slc18a2 C T 19: 59,273,281 S200F probably damaging Het
Slc25a38 A G 9: 120,120,779 D208G probably damaging Het
Smok3c C A 5: 138,065,275 D341E probably damaging Het
Tfcp2 A G 15: 100,513,108 I373T probably damaging Het
Tnpo3 T A 6: 29,589,183 D56V probably damaging Het
Trrap T A 5: 144,844,211 Y3261N probably damaging Het
Ulk4 A G 9: 121,204,738 C612R probably damaging Het
Ush1g G T 11: 115,319,181 D62E probably damaging Het
Vmn2r124 A G 17: 18,063,037 N331S Het
Vmn2r4 T C 3: 64,406,637 I308V probably damaging Het
Vwa8 T A 14: 78,947,262 V400E probably benign Het
Washc2 A G 6: 116,258,955 D1129G probably benign Het
Washc5 G T 15: 59,335,122 Q1101K probably damaging Het
Wfdc17 G T 11: 83,704,112 L7F probably benign Het
Xpo4 T C 14: 57,597,956 K636R probably damaging Het
Zan T A 5: 137,456,674 T1367S unknown Het
Zfp691 A T 4: 119,170,664 S124T probably damaging Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32021556 utr 5 prime probably benign
IGL01799:Myo7b APN 18 31962770 missense probably damaging 1.00
IGL01881:Myo7b APN 18 32000267 splice site probably benign
IGL01883:Myo7b APN 18 31998151 missense probably damaging 1.00
IGL01934:Myo7b APN 18 32001341 critical splice donor site probably null
IGL01980:Myo7b APN 18 31961900 missense possibly damaging 0.86
IGL02506:Myo7b APN 18 31967154 missense probably damaging 1.00
IGL02704:Myo7b APN 18 31966961 missense probably benign 0.13
IGL02929:Myo7b APN 18 31994925 missense probably benign 0.19
IGL03149:Myo7b APN 18 32014302 missense probably damaging 1.00
IGL03335:Myo7b APN 18 31985020 missense possibly damaging 0.81
IGL03372:Myo7b APN 18 31998601 missense probably damaging 1.00
IGL03385:Myo7b APN 18 31989577 missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 31961206 missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 31959466 missense possibly damaging 0.80
PIT4445001:Myo7b UTSW 18 31962352 missense probably damaging 0.96
R0034:Myo7b UTSW 18 31960860 missense probably damaging 1.00
R0138:Myo7b UTSW 18 32010151 missense probably damaging 1.00
R0149:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0226:Myo7b UTSW 18 31972896 missense probably benign 0.00
R0312:Myo7b UTSW 18 32014337 missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0506:Myo7b UTSW 18 31964386 critical splice donor site probably null
R0524:Myo7b UTSW 18 32013424 missense possibly damaging 0.91
R0645:Myo7b UTSW 18 31994909 missense probably benign 0.10
R0724:Myo7b UTSW 18 32005549 splice site probably benign
R0731:Myo7b UTSW 18 31961825 splice site probably null
R0762:Myo7b UTSW 18 31983944 missense probably benign 0.01
R0843:Myo7b UTSW 18 31974084 missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32000070 missense probably damaging 1.00
R0966:Myo7b UTSW 18 31998763 missense probably damaging 1.00
R1205:Myo7b UTSW 18 31994342 missense probably damaging 1.00
R1387:Myo7b UTSW 18 31983752 splice site probably benign
R1523:Myo7b UTSW 18 31966876 missense probably damaging 1.00
R1544:Myo7b UTSW 18 31994909 missense probably benign 0.10
R1623:Myo7b UTSW 18 32000051 missense probably damaging 1.00
R1780:Myo7b UTSW 18 31961185 missense probably damaging 1.00
R1785:Myo7b UTSW 18 31994897 missense probably benign
R1786:Myo7b UTSW 18 31994897 missense probably benign
R1796:Myo7b UTSW 18 31986675 missense possibly damaging 0.93
R1907:Myo7b UTSW 18 31976999 missense possibly damaging 0.89
R2027:Myo7b UTSW 18 31984960 missense probably benign
R2102:Myo7b UTSW 18 31999978 missense probably damaging 1.00
R2174:Myo7b UTSW 18 31983557 missense probably damaging 1.00
R2272:Myo7b UTSW 18 31977043 missense probably benign 0.41
R2323:Myo7b UTSW 18 31971345 missense probably damaging 1.00
R2365:Myo7b UTSW 18 32014331 missense probably damaging 0.98
R3078:Myo7b UTSW 18 31967184 missense probably benign 0.04
R3522:Myo7b UTSW 18 32010079 missense probably damaging 1.00
R3788:Myo7b UTSW 18 31974112 missense possibly damaging 0.95
R3880:Myo7b UTSW 18 31969514 missense probably damaging 0.96
R4334:Myo7b UTSW 18 31976987 missense probably damaging 1.00
R4343:Myo7b UTSW 18 31983627 missense probably damaging 1.00
R4497:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4498:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4551:Myo7b UTSW 18 31985108 missense probably benign 0.01
R4593:Myo7b UTSW 18 32013375 missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32003487 splice site probably null
R4646:Myo7b UTSW 18 31994369 missense probably benign 0.25
R4648:Myo7b UTSW 18 31967125 splice site probably null
R4737:Myo7b UTSW 18 31998602 missense probably damaging 1.00
R4765:Myo7b UTSW 18 31961900 missense probably benign 0.00
R4790:Myo7b UTSW 18 32000105 splice site probably null
R4909:Myo7b UTSW 18 31964436 missense probably benign 0.01
R5027:Myo7b UTSW 18 31975212 missense probably benign 0.22
R5034:Myo7b UTSW 18 31971387 missense probably damaging 1.00
R5112:Myo7b UTSW 18 31983587 missense probably damaging 1.00
R5266:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5267:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5348:Myo7b UTSW 18 31983919 missense probably damaging 0.96
R5457:Myo7b UTSW 18 31971450 splice site probably null
R5540:Myo7b UTSW 18 32007090 missense probably damaging 1.00
R5628:Myo7b UTSW 18 31974187 missense probably benign
R5815:Myo7b UTSW 18 31966288 missense probably damaging 1.00
R6062:Myo7b UTSW 18 31967990 missense possibly damaging 0.94
R6137:Myo7b UTSW 18 31999974 missense probably damaging 1.00
R6158:Myo7b UTSW 18 31988549 missense probably benign 0.00
R6218:Myo7b UTSW 18 31959454 missense probably benign 0.10
R6256:Myo7b UTSW 18 31983695 missense probably damaging 1.00
R6257:Myo7b UTSW 18 32013415 missense probably damaging 1.00
R6265:Myo7b UTSW 18 31998150 missense probably damaging 1.00
R6302:Myo7b UTSW 18 31994386 missense probably damaging 0.98
R6438:Myo7b UTSW 18 31966329 missense probably damaging 1.00
R6654:Myo7b UTSW 18 31990269 missense possibly damaging 0.46
R7030:Myo7b UTSW 18 31971573 missense probably damaging 1.00
R7090:Myo7b UTSW 18 31998712 missense probably damaging 1.00
R7210:Myo7b UTSW 18 32007102 missense probably damaging 1.00
R7218:Myo7b UTSW 18 31981001 missense probably benign 0.05
R7378:Myo7b UTSW 18 31966239 missense probably damaging 1.00
R7458:Myo7b UTSW 18 31988551 missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32013267 missense probably damaging 0.99
R7559:Myo7b UTSW 18 31983360 missense probably benign 0.01
R7667:Myo7b UTSW 18 31961905 missense probably benign
R7737:Myo7b UTSW 18 32014204 nonsense probably null
R7942:Myo7b UTSW 18 32013369 missense probably damaging 0.98
R8030:Myo7b UTSW 18 31998082 missense probably damaging 0.96
R8114:Myo7b UTSW 18 31965624 missense probably damaging 1.00
R8338:Myo7b UTSW 18 31971355 missense probably damaging 0.96
R8341:Myo7b UTSW 18 31983926 missense probably benign 0.39
R8406:Myo7b UTSW 18 31959813 missense probably damaging 1.00
R8464:Myo7b UTSW 18 31962704 missense probably benign 0.00
R8517:Myo7b UTSW 18 31967191 missense possibly damaging 0.87
R8537:Myo7b UTSW 18 31977089 missense probably benign 0.08
R8546:Myo7b UTSW 18 31990148 missense probably benign 0.19
R8721:Myo7b UTSW 18 32007011 missense probably damaging 1.00
R8770:Myo7b UTSW 18 31981071 missense probably benign 0.03
R8853:Myo7b UTSW 18 31986691 missense possibly damaging 0.67
X0027:Myo7b UTSW 18 31965636 missense probably damaging 1.00
Z1176:Myo7b UTSW 18 31980998 missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 31985056 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAACTTGGTGCAGCGCTC -3'
(R):5'- AGTGCTCCCCTATTGAAGGC -3'

Sequencing Primer
(F):5'- CCCTGACACTGGCTTGTAG -3'
(R):5'- AAGGCTTTGTGTCCAGCATCAAG -3'
Posted On2021-07-15