Incidental Mutation 'R8842:Man2a2'
ID 674475
Institutional Source Beutler Lab
Gene Symbol Man2a2
Ensembl Gene ENSMUSG00000038886
Gene Name mannosidase 2, alpha 2
Synonyms MX, alpha mannosidase IIx, 1700052O22Rik, 4931438M07Rik
MMRRC Submission 068669-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.231) question?
Stock # R8842 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 79998845-80021123 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80003067 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1014 (L1014P)
Ref Sequence ENSEMBL: ENSMUSP00000095949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098346] [ENSMUST00000206089] [ENSMUST00000206807]
AlphaFold Q8BRK9
Predicted Effect probably damaging
Transcript: ENSMUST00000098346
AA Change: L1014P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095949
Gene: ENSMUSG00000038886
AA Change: L1014P

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_hydro_38 167 497 1.9e-109 PFAM
Alpha-mann_mid 502 588 1.4e-32 SMART
Pfam:Glyco_hydro_38C 648 1148 1.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206089
Predicted Effect probably benign
Transcript: ENSMUST00000206807
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.1%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Homozygous null males are infertile due to a defect during spermatogenesis involving the premature release of germ cells from the seminiferous tubules into the epididymis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap17 G A 7: 122,893,750 (GRCm39) P557S probably benign Het
Atad5 G T 11: 80,000,910 (GRCm39) D1014Y possibly damaging Het
Bmp6 T A 13: 38,530,359 (GRCm39) S151T probably benign Het
Bmp6 C T 13: 38,682,795 (GRCm39) Q459* probably null Het
Ccdc39 A G 3: 33,880,612 (GRCm39) Y452H probably damaging Het
Cenpj A G 14: 56,780,329 (GRCm39) Y961H probably damaging Het
Col6a6 A T 9: 105,655,166 (GRCm39) Y852N probably damaging Het
Cpne8 A G 15: 90,456,218 (GRCm39) I156T probably benign Het
Cul1 T A 6: 47,492,010 (GRCm39) L430Q probably damaging Het
Dhx30 A G 9: 109,914,296 (GRCm39) S1031P probably benign Het
Dhx9 A T 1: 153,338,335 (GRCm39) F774I possibly damaging Het
Fezf2 A C 14: 12,345,079 (GRCm38) M36R probably damaging Het
Gbp2b A T 3: 142,312,576 (GRCm39) I320L probably benign Het
Gemin6 T A 17: 80,533,115 (GRCm39) V16D possibly damaging Het
Gpr158 T A 2: 21,581,751 (GRCm39) V410D possibly damaging Het
H2-DMb2 C T 17: 34,366,904 (GRCm39) T112M probably damaging Het
Hecw2 T C 1: 53,990,033 (GRCm39) T114A Het
Herc2 G T 7: 55,738,059 (GRCm39) R234L probably damaging Het
Igsf11 A G 16: 38,829,243 (GRCm39) I46V probably benign Het
Izumo1r C T 9: 14,813,705 (GRCm39) G38S possibly damaging Het
Katna1 A G 10: 7,614,600 (GRCm39) D36G probably benign Het
Kdm1b G T 13: 47,231,832 (GRCm39) R697L probably damaging Het
Kif1b T A 4: 149,338,196 (GRCm39) I483F probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Lrp1b G A 2: 41,158,417 (GRCm39) T1714I Het
Marf1 T C 16: 13,935,169 (GRCm39) E1533G probably damaging Het
Mfsd2a A T 4: 122,845,623 (GRCm39) I176N probably damaging Het
Mterf1b T A 5: 4,246,961 (GRCm39) F201I possibly damaging Het
Neurod2 T C 11: 98,218,507 (GRCm39) E219G probably damaging Het
Nln T C 13: 104,209,486 (GRCm39) E29G probably benign Het
Obscn G A 11: 58,892,861 (GRCm39) T6795M possibly damaging Het
Or1e1c G T 11: 73,266,186 (GRCm39) V207F probably benign Het
Or1i2 A G 10: 78,447,635 (GRCm39) V280A possibly damaging Het
Or1n1 C A 2: 36,749,539 (GRCm39) A274S probably benign Het
Or4c118 C T 2: 88,975,074 (GRCm39) V98I probably benign Het
Otog A T 7: 45,895,948 (GRCm39) I138F probably damaging Het
Pdcd2l G A 7: 33,884,192 (GRCm39) Q337* probably null Het
Ptprk A T 10: 28,442,497 (GRCm39) N859I probably damaging Het
Pygl G T 12: 70,274,368 (GRCm39) probably benign Het
Sema4d C T 13: 51,863,018 (GRCm39) A447T probably benign Het
Slc27a6 A T 18: 58,712,888 (GRCm39) S237C probably benign Het
Smarcc1 G A 9: 110,051,199 (GRCm39) M1006I possibly damaging Het
Sult2a2 G T 7: 13,472,192 (GRCm39) G130C probably damaging Het
Trpm7 T A 2: 126,663,131 (GRCm39) H1039L probably benign Het
Wdr64 T G 1: 175,599,893 (GRCm39) N573K probably benign Het
Zbtb48 T C 4: 152,104,496 (GRCm39) I611V probably benign Het
Zer1 T C 2: 30,001,062 (GRCm39) S120G possibly damaging Het
Zswim4 C T 8: 84,940,699 (GRCm39) R800Q probably damaging Het
Other mutations in Man2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Man2a2 APN 7 80,010,880 (GRCm39) missense possibly damaging 0.94
IGL01405:Man2a2 APN 7 80,010,682 (GRCm39) missense probably benign 0.00
IGL01717:Man2a2 APN 7 80,017,113 (GRCm39) missense probably damaging 1.00
IGL01843:Man2a2 APN 7 80,012,654 (GRCm39) missense probably benign
IGL02212:Man2a2 APN 7 80,012,056 (GRCm39) missense probably benign 0.00
IGL02383:Man2a2 APN 7 80,009,388 (GRCm39) missense probably damaging 0.99
IGL02434:Man2a2 APN 7 80,009,388 (GRCm39) missense probably damaging 0.99
IGL02493:Man2a2 APN 7 80,019,363 (GRCm39) missense possibly damaging 0.68
IGL02528:Man2a2 APN 7 80,009,388 (GRCm39) missense probably damaging 0.99
IGL02529:Man2a2 APN 7 80,009,388 (GRCm39) missense probably damaging 0.99
IGL02530:Man2a2 APN 7 80,009,388 (GRCm39) missense probably damaging 0.99
IGL02534:Man2a2 APN 7 80,009,388 (GRCm39) missense probably damaging 0.99
IGL02869:Man2a2 APN 7 80,013,689 (GRCm39) missense probably benign 0.00
IGL03084:Man2a2 APN 7 80,002,691 (GRCm39) missense possibly damaging 0.88
IGL03088:Man2a2 APN 7 80,009,082 (GRCm39) missense possibly damaging 0.91
IGL03377:Man2a2 APN 7 80,008,800 (GRCm39) splice site probably null
IGL03412:Man2a2 APN 7 80,016,746 (GRCm39) missense probably damaging 1.00
dugong UTSW 7 80,010,669 (GRCm39) missense probably benign 0.12
R2090_Man2a2_705 UTSW 7 80,013,858 (GRCm39) unclassified probably benign
R7828_Man2a2_437 UTSW 7 80,016,674 (GRCm39) missense probably damaging 0.98
R0112:Man2a2 UTSW 7 80,008,024 (GRCm39) missense probably damaging 0.99
R0119:Man2a2 UTSW 7 80,017,153 (GRCm39) missense probably damaging 1.00
R0646:Man2a2 UTSW 7 80,012,945 (GRCm39) missense possibly damaging 0.53
R1184:Man2a2 UTSW 7 80,012,713 (GRCm39) missense possibly damaging 0.79
R1445:Man2a2 UTSW 7 80,018,310 (GRCm39) missense probably benign 0.06
R1626:Man2a2 UTSW 7 80,017,450 (GRCm39) missense probably damaging 1.00
R1739:Man2a2 UTSW 7 80,012,186 (GRCm39) missense probably benign 0.10
R1820:Man2a2 UTSW 7 80,008,681 (GRCm39) missense probably benign 0.22
R2090:Man2a2 UTSW 7 80,013,858 (GRCm39) unclassified probably benign
R2144:Man2a2 UTSW 7 80,013,264 (GRCm39) missense probably damaging 1.00
R2150:Man2a2 UTSW 7 80,017,532 (GRCm39) missense probably damaging 1.00
R3882:Man2a2 UTSW 7 80,012,063 (GRCm39) missense possibly damaging 0.70
R4181:Man2a2 UTSW 7 80,001,487 (GRCm39) missense possibly damaging 0.79
R4285:Man2a2 UTSW 7 80,018,367 (GRCm39) missense probably damaging 1.00
R4302:Man2a2 UTSW 7 80,001,487 (GRCm39) missense possibly damaging 0.79
R4440:Man2a2 UTSW 7 80,001,463 (GRCm39) missense probably benign 0.37
R4494:Man2a2 UTSW 7 80,009,023 (GRCm39) splice site probably null
R4564:Man2a2 UTSW 7 80,018,586 (GRCm39) missense probably benign 0.00
R4631:Man2a2 UTSW 7 80,012,211 (GRCm39) missense probably benign 0.10
R5328:Man2a2 UTSW 7 80,018,504 (GRCm39) missense probably benign 0.06
R5329:Man2a2 UTSW 7 80,010,876 (GRCm39) missense possibly damaging 0.82
R5468:Man2a2 UTSW 7 80,002,729 (GRCm39) missense probably damaging 0.98
R5774:Man2a2 UTSW 7 80,018,106 (GRCm39) missense probably damaging 1.00
R5824:Man2a2 UTSW 7 80,002,780 (GRCm39) missense probably benign 0.00
R5915:Man2a2 UTSW 7 80,010,669 (GRCm39) missense probably benign 0.12
R5937:Man2a2 UTSW 7 80,013,251 (GRCm39) missense probably damaging 1.00
R6101:Man2a2 UTSW 7 80,016,749 (GRCm39) missense probably damaging 1.00
R6105:Man2a2 UTSW 7 80,016,749 (GRCm39) missense probably damaging 1.00
R6481:Man2a2 UTSW 7 80,013,819 (GRCm39) missense probably damaging 0.99
R6592:Man2a2 UTSW 7 80,002,947 (GRCm39) missense probably damaging 0.98
R6869:Man2a2 UTSW 7 80,012,693 (GRCm39) missense probably benign 0.35
R6918:Man2a2 UTSW 7 80,002,940 (GRCm39) missense possibly damaging 0.91
R7137:Man2a2 UTSW 7 80,009,499 (GRCm39) missense probably benign 0.19
R7236:Man2a2 UTSW 7 80,018,653 (GRCm39) missense probably damaging 1.00
R7496:Man2a2 UTSW 7 80,002,745 (GRCm39) missense probably damaging 1.00
R7522:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7523:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7524:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7583:Man2a2 UTSW 7 80,016,692 (GRCm39) missense probably damaging 1.00
R7681:Man2a2 UTSW 7 80,001,497 (GRCm39) missense possibly damaging 0.49
R7828:Man2a2 UTSW 7 80,016,674 (GRCm39) missense probably damaging 0.98
R7843:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7845:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7847:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7848:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7984:Man2a2 UTSW 7 80,003,056 (GRCm39) missense probably damaging 0.99
R8194:Man2a2 UTSW 7 80,010,766 (GRCm39) missense probably benign
R8296:Man2a2 UTSW 7 80,018,656 (GRCm39) missense probably damaging 0.99
R8376:Man2a2 UTSW 7 80,010,671 (GRCm39) nonsense probably null
R8515:Man2a2 UTSW 7 80,018,038 (GRCm39) missense possibly damaging 0.88
R9205:Man2a2 UTSW 7 80,010,868 (GRCm39) missense probably benign
R9563:Man2a2 UTSW 7 80,006,101 (GRCm39) missense probably benign
X0057:Man2a2 UTSW 7 80,012,072 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTAGCACTGACTGGGACACTC -3'
(R):5'- TGGTCACCTGACTGTCTGTG -3'

Sequencing Primer
(F):5'- TGACTGGGACACTCACCTC -3'
(R):5'- CATAGTTAGTAGCCACCTCTGAGG -3'
Posted On 2021-07-15