Incidental Mutation 'R8842:Man2a2'
ID 674475
Institutional Source Beutler Lab
Gene Symbol Man2a2
Ensembl Gene ENSMUSG00000038886
Gene Name mannosidase 2, alpha 2
Synonyms alpha mannosidase IIx, 1700052O22Rik, MX, 4931438M07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock # R8842 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 80349097-80371375 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80353319 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1014 (L1014P)
Ref Sequence ENSEMBL: ENSMUSP00000095949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098346] [ENSMUST00000206089] [ENSMUST00000206807]
AlphaFold Q8BRK9
Predicted Effect probably damaging
Transcript: ENSMUST00000098346
AA Change: L1014P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095949
Gene: ENSMUSG00000038886
AA Change: L1014P

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_hydro_38 167 497 1.9e-109 PFAM
Alpha-mann_mid 502 588 1.4e-32 SMART
Pfam:Glyco_hydro_38C 648 1148 1.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206089
Predicted Effect probably benign
Transcript: ENSMUST00000206807
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.1%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Homozygous null males are infertile due to a defect during spermatogenesis involving the premature release of germ cells from the seminiferous tubules into the epididymis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap17 G A 7: 123,294,527 P557S probably benign Het
Atad5 G T 11: 80,110,084 D1014Y possibly damaging Het
Bmp6 T A 13: 38,346,383 S151T probably benign Het
Bmp6 C T 13: 38,498,819 Q459* probably null Het
Ccdc39 A G 3: 33,826,463 Y452H probably damaging Het
Cenpj A G 14: 56,542,872 Y961H probably damaging Het
Col6a6 A T 9: 105,777,967 Y852N probably damaging Het
Cpne8 A G 15: 90,572,015 I156T probably benign Het
Cul1 T A 6: 47,515,076 L430Q probably damaging Het
Dhx30 A G 9: 110,085,228 S1031P probably benign Het
Dhx9 A T 1: 153,462,589 F774I possibly damaging Het
Fezf2 A C 14: 12,345,079 M36R probably damaging Het
Gbp2b A T 3: 142,606,815 I320L probably benign Het
Gemin6 T A 17: 80,225,686 V16D possibly damaging Het
Gpr158 T A 2: 21,576,940 V410D possibly damaging Het
H2-DMb2 C T 17: 34,147,930 T112M probably damaging Het
Hecw2 T C 1: 53,950,874 T114A Het
Herc2 G T 7: 56,088,311 R234L probably damaging Het
Igsf11 A G 16: 39,008,881 I46V probably benign Het
Izumo1r C T 9: 14,902,409 G38S possibly damaging Het
Katna1 A G 10: 7,738,836 D36G probably benign Het
Kdm1b G T 13: 47,078,356 R697L probably damaging Het
Kif1b T A 4: 149,253,739 I483F probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrp1b G A 2: 41,268,405 T1714I Het
Marf1 T C 16: 14,117,305 E1533G probably damaging Het
Mfsd2a A T 4: 122,951,830 I176N probably damaging Het
Mterf1b T A 5: 4,196,961 F201I possibly damaging Het
Neurod2 T C 11: 98,327,681 E219G probably damaging Het
Nln T C 13: 104,072,978 E29G probably benign Het
Obscn G A 11: 59,002,035 T6795M possibly damaging Het
Olfr1223 C T 2: 89,144,730 V98I probably benign Het
Olfr1357 A G 10: 78,611,801 V280A possibly damaging Het
Olfr351 C A 2: 36,859,527 A274S probably benign Het
Olfr376 G T 11: 73,375,360 V207F probably benign Het
Otog A T 7: 46,246,524 I138F probably damaging Het
Pdcd2l G A 7: 34,184,767 Q337* probably null Het
Ptprk A T 10: 28,566,501 N859I probably damaging Het
Pygl G T 12: 70,227,594 probably benign Het
Sema4d C T 13: 51,708,982 A447T probably benign Het
Slc27a6 A T 18: 58,579,816 S237C probably benign Het
Smarcc1 G A 9: 110,222,131 M1006I possibly damaging Het
Sult2a2 G T 7: 13,738,267 G130C probably damaging Het
Trpm7 T A 2: 126,821,211 H1039L probably benign Het
Wdr64 T G 1: 175,772,327 N573K probably benign Het
Zbtb48 T C 4: 152,020,039 I611V probably benign Het
Zer1 T C 2: 30,111,050 S120G possibly damaging Het
Zswim4 C T 8: 84,214,070 R800Q probably damaging Het
Other mutations in Man2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Man2a2 APN 7 80361132 missense possibly damaging 0.94
IGL01405:Man2a2 APN 7 80360934 missense probably benign 0.00
IGL01717:Man2a2 APN 7 80367365 missense probably damaging 1.00
IGL01843:Man2a2 APN 7 80362906 missense probably benign
IGL02212:Man2a2 APN 7 80362308 missense probably benign 0.00
IGL02383:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02434:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02493:Man2a2 APN 7 80369615 missense possibly damaging 0.68
IGL02528:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02529:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02530:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02534:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02869:Man2a2 APN 7 80363941 missense probably benign 0.00
IGL03084:Man2a2 APN 7 80352943 missense possibly damaging 0.88
IGL03088:Man2a2 APN 7 80359334 missense possibly damaging 0.91
IGL03377:Man2a2 APN 7 80359052 splice site probably null
IGL03412:Man2a2 APN 7 80366998 missense probably damaging 1.00
dugong UTSW 7 80360921 missense probably benign 0.12
R2090_Man2a2_705 UTSW 7 80364110 unclassified probably benign
R7828_Man2a2_437 UTSW 7 80366926 missense probably damaging 0.98
R0112:Man2a2 UTSW 7 80358276 missense probably damaging 0.99
R0119:Man2a2 UTSW 7 80367405 missense probably damaging 1.00
R0646:Man2a2 UTSW 7 80363197 missense possibly damaging 0.53
R1184:Man2a2 UTSW 7 80362965 missense possibly damaging 0.79
R1445:Man2a2 UTSW 7 80368562 missense probably benign 0.06
R1626:Man2a2 UTSW 7 80367702 missense probably damaging 1.00
R1739:Man2a2 UTSW 7 80362438 missense probably benign 0.10
R1820:Man2a2 UTSW 7 80358933 missense probably benign 0.22
R2090:Man2a2 UTSW 7 80364110 unclassified probably benign
R2144:Man2a2 UTSW 7 80363516 missense probably damaging 1.00
R2150:Man2a2 UTSW 7 80367784 missense probably damaging 1.00
R3882:Man2a2 UTSW 7 80362315 missense possibly damaging 0.70
R4181:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4285:Man2a2 UTSW 7 80368619 missense probably damaging 1.00
R4302:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4440:Man2a2 UTSW 7 80351715 missense probably benign 0.37
R4494:Man2a2 UTSW 7 80359275 splice site probably null
R4564:Man2a2 UTSW 7 80368838 missense probably benign 0.00
R4631:Man2a2 UTSW 7 80362463 missense probably benign 0.10
R5328:Man2a2 UTSW 7 80368756 missense probably benign 0.06
R5329:Man2a2 UTSW 7 80361128 missense possibly damaging 0.82
R5468:Man2a2 UTSW 7 80352981 missense probably damaging 0.98
R5774:Man2a2 UTSW 7 80368358 missense probably damaging 1.00
R5824:Man2a2 UTSW 7 80353032 missense probably benign 0.00
R5915:Man2a2 UTSW 7 80360921 missense probably benign 0.12
R5937:Man2a2 UTSW 7 80363503 missense probably damaging 1.00
R6101:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6105:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6481:Man2a2 UTSW 7 80364071 missense probably damaging 0.99
R6592:Man2a2 UTSW 7 80353199 missense probably damaging 0.98
R6869:Man2a2 UTSW 7 80362945 missense probably benign 0.35
R6918:Man2a2 UTSW 7 80353192 missense possibly damaging 0.91
R7137:Man2a2 UTSW 7 80359751 missense probably benign 0.19
R7236:Man2a2 UTSW 7 80368905 missense probably damaging 1.00
R7496:Man2a2 UTSW 7 80352997 missense probably damaging 1.00
R7522:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7523:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7524:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7583:Man2a2 UTSW 7 80366944 missense probably damaging 1.00
R7681:Man2a2 UTSW 7 80351749 missense possibly damaging 0.49
R7828:Man2a2 UTSW 7 80366926 missense probably damaging 0.98
R7843:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7845:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7847:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7848:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7984:Man2a2 UTSW 7 80353308 missense probably damaging 0.99
R8194:Man2a2 UTSW 7 80361018 missense probably benign
R8296:Man2a2 UTSW 7 80368908 missense probably damaging 0.99
R8376:Man2a2 UTSW 7 80360923 nonsense probably null
R8515:Man2a2 UTSW 7 80368290 missense possibly damaging 0.88
R9205:Man2a2 UTSW 7 80361120 missense probably benign
R9563:Man2a2 UTSW 7 80356353 missense not run
X0057:Man2a2 UTSW 7 80362324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTAGCACTGACTGGGACACTC -3'
(R):5'- TGGTCACCTGACTGTCTGTG -3'

Sequencing Primer
(F):5'- TGACTGGGACACTCACCTC -3'
(R):5'- CATAGTTAGTAGCCACCTCTGAGG -3'
Posted On 2021-07-15