Incidental Mutation 'R8843:Myo3b'
ID 674509
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission 068670-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8843 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 69869470-70259542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 70088325 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 863 (G863W)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably damaging
Transcript: ENSMUST00000060208
AA Change: G863W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: G863W

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112243
AA Change: G835W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: G835W

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 C G 9: 21,440,331 (GRCm39) Q106E probably benign Het
Abi2 A G 1: 60,492,888 (GRCm39) M387V probably null Het
Adra2c A T 5: 35,437,707 (GRCm39) N160Y probably damaging Het
Ager G A 17: 34,819,716 (GRCm39) R383H probably benign Het
Arhgef28 C T 13: 98,130,557 (GRCm39) R427H probably benign Het
Atl1 T A 12: 69,972,922 (GRCm39) S81T probably damaging Het
Ccdc80 T A 16: 44,947,470 (GRCm39) probably benign Het
Cdh10 T A 15: 19,013,487 (GRCm39) F696I possibly damaging Het
Cdk2ap2 T C 19: 4,147,429 (GRCm39) S2P unknown Het
Cela1 G A 15: 100,580,821 (GRCm39) T145I probably benign Het
Celsr2 A T 3: 108,303,443 (GRCm39) probably benign Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 105,036,334 (GRCm39) probably null Het
Col22a1 A G 15: 71,878,503 (GRCm39) I218T probably damaging Het
Copb1 T C 7: 113,820,935 (GRCm39) I785V possibly damaging Het
Dnajc16 A T 4: 141,492,002 (GRCm39) V607E possibly damaging Het
Dnali1 A T 4: 124,957,414 (GRCm39) L110Q probably damaging Het
Epn1 A G 7: 5,096,375 (GRCm39) E223G probably benign Het
Erbb3 A G 10: 128,414,325 (GRCm39) L473P possibly damaging Het
Fhip1a A G 3: 85,568,318 (GRCm39) I1067T possibly damaging Het
Gadl1 T A 9: 115,835,569 (GRCm39) D332E probably benign Het
Gm10801 TC TCGAC 2: 98,494,151 (GRCm39) probably benign Het
Heg1 A G 16: 33,570,863 (GRCm39) S1188G probably null Het
Hipk3 G A 2: 104,268,242 (GRCm39) A575V probably benign Het
Htt T A 5: 35,046,809 (GRCm39) I2375N possibly damaging Het
Klhl24 A T 16: 19,938,980 (GRCm39) K512* probably null Het
Krtdap A T 7: 30,488,952 (GRCm39) Y40F probably damaging Het
Lhx1 A T 11: 84,410,455 (GRCm39) S381T probably benign Het
Lnpep G A 17: 17,773,203 (GRCm39) P655L probably damaging Het
Map6d1 A G 16: 20,055,386 (GRCm39) V150A probably benign Het
Marchf10 A G 11: 105,292,802 (GRCm39) S202P possibly damaging Het
Med1 A C 11: 98,080,102 (GRCm39) L13R possibly damaging Het
Mxi1 G A 19: 53,360,126 (GRCm39) G283S probably damaging Het
Myh7 T G 14: 55,212,752 (GRCm39) D1431A probably damaging Het
Nat8f1 G T 6: 85,887,907 (GRCm39) Q18K probably benign Het
Ncaph A G 2: 126,950,529 (GRCm39) V576A probably benign Het
Nfkbia T G 12: 55,539,196 (GRCm39) D39A possibly damaging Het
Nrxn2 G T 19: 6,555,057 (GRCm39) G1179C probably damaging Het
Or12k8 A C 2: 36,975,307 (GRCm39) V151G probably damaging Het
P4ha1 A G 10: 59,205,455 (GRCm39) D495G probably damaging Het
Phf20 C T 2: 156,144,843 (GRCm39) A817V probably benign Het
Phlpp2 A T 8: 110,652,431 (GRCm39) I592F probably benign Het
Polq A G 16: 36,832,280 (GRCm39) S7G unknown Het
Ppfia3 G T 7: 44,997,941 (GRCm39) Q729K probably benign Het
Prmt8 A C 6: 127,706,462 (GRCm39) F110V probably damaging Het
Psca A T 15: 74,587,868 (GRCm39) probably null Het
Pus7 G T 5: 23,980,754 (GRCm39) D165E probably benign Het
Raver2 A G 4: 100,994,942 (GRCm39) E555G probably damaging Het
Rb1cc1 G A 1: 6,315,395 (GRCm39) V457M probably damaging Het
Rbp3 A G 14: 33,676,522 (GRCm39) R157G probably benign Het
Rin3 T G 12: 102,335,857 (GRCm39) H589Q probably benign Het
Scart2 A C 7: 139,828,913 (GRCm39) T191P possibly damaging Het
Sgk2 T A 2: 162,854,890 (GRCm39) S334T probably damaging Het
Sh2d4b T C 14: 40,614,832 (GRCm39) M31V probably benign Het
Slc23a3 G A 1: 75,106,271 (GRCm39) T316I probably damaging Het
Slc5a4b C A 10: 75,910,925 (GRCm39) G304C probably damaging Het
Slc7a14 A G 3: 31,311,759 (GRCm39) V87A probably damaging Het
Slitrk3 A T 3: 72,956,164 (GRCm39) N869K probably benign Het
St8sia6 T C 2: 13,661,896 (GRCm39) R312G possibly damaging Het
Strip2 A T 6: 29,923,968 (GRCm39) E94V probably benign Het
Sycp2 T C 2: 177,990,052 (GRCm39) D1398G probably damaging Het
Syne1 C A 10: 5,143,040 (GRCm39) V114F possibly damaging Het
Syne1 T C 10: 5,280,204 (GRCm39) K1630E probably benign Het
Sytl2 A G 7: 90,025,334 (GRCm39) N441D probably benign Het
Thsd7a A G 6: 12,501,136 (GRCm39) C424R Het
Tln2 T C 9: 67,302,827 (GRCm39) D48G probably damaging Het
Treml1 A G 17: 48,673,852 (GRCm39) T288A probably damaging Het
Ttn T C 2: 76,596,113 (GRCm39) I20267V probably benign Het
Ttn A T 2: 76,679,259 (GRCm39) V10821D unknown Het
Vmn2r111 A C 17: 22,767,011 (GRCm39) S829A probably benign Het
Xcl1 T A 1: 164,763,079 (GRCm39) probably benign Het
Zdhhc23 A T 16: 43,794,227 (GRCm39) V149E probably damaging Het
Zfp273 A T 13: 67,970,387 (GRCm39) I12F possibly damaging Het
Zfp874a A T 13: 67,590,764 (GRCm39) C307S probably damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 69,935,989 (GRCm39) splice site probably benign
IGL00959:Myo3b APN 2 70,144,636 (GRCm39) missense probably damaging 1.00
IGL01069:Myo3b APN 2 70,075,735 (GRCm39) missense probably benign 0.22
IGL01116:Myo3b APN 2 70,119,730 (GRCm39) missense probably damaging 1.00
IGL02097:Myo3b APN 2 70,069,173 (GRCm39) missense probably damaging 1.00
IGL02220:Myo3b APN 2 70,119,923 (GRCm39) splice site probably benign
IGL02553:Myo3b APN 2 69,925,568 (GRCm39) missense probably benign 0.00
IGL02557:Myo3b APN 2 70,085,663 (GRCm39) missense probably benign 0.16
IGL02648:Myo3b APN 2 69,935,716 (GRCm39) splice site probably benign
IGL02902:Myo3b APN 2 70,119,745 (GRCm39) missense probably benign 0.36
IGL02981:Myo3b APN 2 69,938,969 (GRCm39) missense probably damaging 1.00
IGL03030:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03031:Myo3b APN 2 70,085,721 (GRCm39) missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03078:Myo3b APN 2 70,117,335 (GRCm39) missense probably damaging 1.00
IGL03224:Myo3b APN 2 70,180,283 (GRCm39) missense probably benign
IGL03329:Myo3b APN 2 70,084,803 (GRCm39) missense probably damaging 1.00
R0079:Myo3b UTSW 2 69,925,502 (GRCm39) missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70,047,510 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0313:Myo3b UTSW 2 70,179,303 (GRCm39) nonsense probably null
R0331:Myo3b UTSW 2 69,925,605 (GRCm39) missense probably damaging 1.00
R0371:Myo3b UTSW 2 70,083,304 (GRCm39) splice site probably benign
R0442:Myo3b UTSW 2 70,069,305 (GRCm39) critical splice donor site probably null
R0964:Myo3b UTSW 2 70,257,193 (GRCm39) missense probably damaging 1.00
R1217:Myo3b UTSW 2 70,161,224 (GRCm39) missense probably benign 0.02
R1429:Myo3b UTSW 2 70,083,351 (GRCm39) missense probably damaging 0.97
R1460:Myo3b UTSW 2 70,062,798 (GRCm39) missense probably benign 0.31
R1617:Myo3b UTSW 2 70,111,562 (GRCm39) missense probably benign 0.00
R1628:Myo3b UTSW 2 70,117,306 (GRCm39) missense probably benign 0.01
R1708:Myo3b UTSW 2 70,075,729 (GRCm39) nonsense probably null
R1940:Myo3b UTSW 2 70,088,419 (GRCm39) missense probably benign 0.01
R2407:Myo3b UTSW 2 70,085,597 (GRCm39) missense probably damaging 1.00
R3081:Myo3b UTSW 2 70,086,927 (GRCm39) splice site probably benign
R3687:Myo3b UTSW 2 70,075,658 (GRCm39) missense probably benign
R3745:Myo3b UTSW 2 70,064,829 (GRCm39) splice site probably benign
R4011:Myo3b UTSW 2 69,926,720 (GRCm39) missense probably benign 0.15
R4074:Myo3b UTSW 2 70,119,808 (GRCm39) missense probably damaging 1.00
R4419:Myo3b UTSW 2 69,926,706 (GRCm39) missense probably damaging 1.00
R4496:Myo3b UTSW 2 70,084,748 (GRCm39) missense probably benign
R4539:Myo3b UTSW 2 69,869,491 (GRCm39) start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70,069,186 (GRCm39) missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R4807:Myo3b UTSW 2 69,936,056 (GRCm39) missense probably damaging 1.00
R4849:Myo3b UTSW 2 70,075,253 (GRCm39) missense probably damaging 0.98
R4997:Myo3b UTSW 2 70,088,427 (GRCm39) missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70,088,412 (GRCm39) missense probably damaging 0.99
R5070:Myo3b UTSW 2 70,083,456 (GRCm39) missense probably damaging 1.00
R5072:Myo3b UTSW 2 69,925,593 (GRCm39) missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70,088,374 (GRCm39) missense probably benign 0.01
R5103:Myo3b UTSW 2 69,926,747 (GRCm39) missense probably benign 0.08
R5109:Myo3b UTSW 2 69,925,637 (GRCm39) missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70,257,232 (GRCm39) missense probably damaging 0.97
R5396:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R5400:Myo3b UTSW 2 69,935,724 (GRCm39) missense probably damaging 1.00
R5468:Myo3b UTSW 2 70,064,785 (GRCm39) missense probably benign 0.00
R5620:Myo3b UTSW 2 70,069,254 (GRCm39) missense probably benign 0.04
R5646:Myo3b UTSW 2 70,144,774 (GRCm39) missense probably damaging 0.97
R5729:Myo3b UTSW 2 69,936,083 (GRCm39) missense probably damaging 1.00
R5943:Myo3b UTSW 2 70,117,285 (GRCm39) missense probably benign 0.03
R5971:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70,069,113 (GRCm39) missense probably benign 0.00
R6138:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70,075,754 (GRCm39) critical splice donor site probably null
R6177:Myo3b UTSW 2 70,143,707 (GRCm39) missense probably benign 0.00
R6421:Myo3b UTSW 2 70,143,700 (GRCm39) missense probably benign 0.02
R6478:Myo3b UTSW 2 70,179,304 (GRCm39) missense probably benign
R6606:Myo3b UTSW 2 70,062,829 (GRCm39) missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70,119,856 (GRCm39) missense probably damaging 1.00
R6982:Myo3b UTSW 2 70,256,409 (GRCm39) missense probably benign 0.02
R6997:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R7032:Myo3b UTSW 2 69,925,608 (GRCm39) missense probably damaging 0.98
R7038:Myo3b UTSW 2 69,925,552 (GRCm39) missense probably benign 0.00
R7062:Myo3b UTSW 2 70,047,501 (GRCm39) missense probably benign 0.00
R7537:Myo3b UTSW 2 70,047,513 (GRCm39) missense probably benign 0.01
R7861:Myo3b UTSW 2 69,939,032 (GRCm39) missense probably damaging 1.00
R7955:Myo3b UTSW 2 69,925,623 (GRCm39) missense probably benign 0.37
R7977:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R7978:Myo3b UTSW 2 70,083,458 (GRCm39) missense probably damaging 1.00
R7987:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R8803:Myo3b UTSW 2 70,083,338 (GRCm39) missense probably benign
R8896:Myo3b UTSW 2 70,069,160 (GRCm39) missense probably damaging 1.00
R8904:Myo3b UTSW 2 70,257,252 (GRCm39) missense probably benign 0.07
R8909:Myo3b UTSW 2 70,083,440 (GRCm39) missense probably damaging 1.00
R9031:Myo3b UTSW 2 70,082,094 (GRCm39) missense probably damaging 0.99
R9052:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
R9251:Myo3b UTSW 2 70,088,425 (GRCm39) nonsense probably null
R9268:Myo3b UTSW 2 70,257,305 (GRCm39) makesense probably null
R9334:Myo3b UTSW 2 70,047,360 (GRCm39) missense probably damaging 1.00
R9377:Myo3b UTSW 2 70,069,242 (GRCm39) missense possibly damaging 0.78
R9457:Myo3b UTSW 2 69,925,553 (GRCm39) missense probably benign 0.01
R9520:Myo3b UTSW 2 70,062,753 (GRCm39) missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70,075,648 (GRCm39) missense probably benign 0.43
R9671:Myo3b UTSW 2 70,086,908 (GRCm39) missense probably damaging 1.00
R9790:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
R9791:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
U15987:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
X0065:Myo3b UTSW 2 70,088,313 (GRCm39) missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70,088,371 (GRCm39) missense probably benign 0.01
Z1177:Myo3b UTSW 2 69,926,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAAGCTAAGATAAATTGACCTGTC -3'
(R):5'- TGACAGTATTTGGGCACTGAC -3'

Sequencing Primer
(F):5'- GACCTGTCAAAAGTACAACTTCTTTC -3'
(R):5'- TTTGGGCACTGACTAAAAGACAC -3'
Posted On 2021-07-15