Incidental Mutation 'R8843:Hipk3'
ID 674513
Institutional Source Beutler Lab
Gene Symbol Hipk3
Ensembl Gene ENSMUSG00000027177
Gene Name homeodomain interacting protein kinase 3
Synonyms DYRK6, FIST3
MMRRC Submission 068670-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8843 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 104256826-104324791 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 104268242 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 575 (A575V)
Ref Sequence ENSEMBL: ENSMUSP00000028600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028600] [ENSMUST00000111124] [ENSMUST00000111125]
AlphaFold Q9ERH7
Predicted Effect probably benign
Transcript: ENSMUST00000028600
AA Change: A575V

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028600
Gene: ENSMUSG00000027177
AA Change: A575V

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111124
AA Change: A575V

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106753
Gene: ENSMUSG00000027177
AA Change: A575V

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000106754
Gene: ENSMUSG00000027177
AA Change: A575V

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 865 880 N/A INTRINSIC
low complexity region 908 927 N/A INTRINSIC
low complexity region 1114 1138 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired insulin secretion and glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 C G 9: 21,440,331 (GRCm39) Q106E probably benign Het
Abi2 A G 1: 60,492,888 (GRCm39) M387V probably null Het
Adra2c A T 5: 35,437,707 (GRCm39) N160Y probably damaging Het
Ager G A 17: 34,819,716 (GRCm39) R383H probably benign Het
Arhgef28 C T 13: 98,130,557 (GRCm39) R427H probably benign Het
Atl1 T A 12: 69,972,922 (GRCm39) S81T probably damaging Het
Ccdc80 T A 16: 44,947,470 (GRCm39) probably benign Het
Cdh10 T A 15: 19,013,487 (GRCm39) F696I possibly damaging Het
Cdk2ap2 T C 19: 4,147,429 (GRCm39) S2P unknown Het
Cela1 G A 15: 100,580,821 (GRCm39) T145I probably benign Het
Celsr2 A T 3: 108,303,443 (GRCm39) probably benign Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 105,036,334 (GRCm39) probably null Het
Col22a1 A G 15: 71,878,503 (GRCm39) I218T probably damaging Het
Copb1 T C 7: 113,820,935 (GRCm39) I785V possibly damaging Het
Dnajc16 A T 4: 141,492,002 (GRCm39) V607E possibly damaging Het
Dnali1 A T 4: 124,957,414 (GRCm39) L110Q probably damaging Het
Epn1 A G 7: 5,096,375 (GRCm39) E223G probably benign Het
Erbb3 A G 10: 128,414,325 (GRCm39) L473P possibly damaging Het
Fhip1a A G 3: 85,568,318 (GRCm39) I1067T possibly damaging Het
Gadl1 T A 9: 115,835,569 (GRCm39) D332E probably benign Het
Gm10801 TC TCGAC 2: 98,494,151 (GRCm39) probably benign Het
Heg1 A G 16: 33,570,863 (GRCm39) S1188G probably null Het
Htt T A 5: 35,046,809 (GRCm39) I2375N possibly damaging Het
Klhl24 A T 16: 19,938,980 (GRCm39) K512* probably null Het
Krtdap A T 7: 30,488,952 (GRCm39) Y40F probably damaging Het
Lhx1 A T 11: 84,410,455 (GRCm39) S381T probably benign Het
Lnpep G A 17: 17,773,203 (GRCm39) P655L probably damaging Het
Map6d1 A G 16: 20,055,386 (GRCm39) V150A probably benign Het
Marchf10 A G 11: 105,292,802 (GRCm39) S202P possibly damaging Het
Med1 A C 11: 98,080,102 (GRCm39) L13R possibly damaging Het
Mxi1 G A 19: 53,360,126 (GRCm39) G283S probably damaging Het
Myh7 T G 14: 55,212,752 (GRCm39) D1431A probably damaging Het
Myo3b G T 2: 70,088,325 (GRCm39) G863W probably damaging Het
Nat8f1 G T 6: 85,887,907 (GRCm39) Q18K probably benign Het
Ncaph A G 2: 126,950,529 (GRCm39) V576A probably benign Het
Nfkbia T G 12: 55,539,196 (GRCm39) D39A possibly damaging Het
Nrxn2 G T 19: 6,555,057 (GRCm39) G1179C probably damaging Het
Or12k8 A C 2: 36,975,307 (GRCm39) V151G probably damaging Het
P4ha1 A G 10: 59,205,455 (GRCm39) D495G probably damaging Het
Phf20 C T 2: 156,144,843 (GRCm39) A817V probably benign Het
Phlpp2 A T 8: 110,652,431 (GRCm39) I592F probably benign Het
Polq A G 16: 36,832,280 (GRCm39) S7G unknown Het
Ppfia3 G T 7: 44,997,941 (GRCm39) Q729K probably benign Het
Prmt8 A C 6: 127,706,462 (GRCm39) F110V probably damaging Het
Psca A T 15: 74,587,868 (GRCm39) probably null Het
Pus7 G T 5: 23,980,754 (GRCm39) D165E probably benign Het
Raver2 A G 4: 100,994,942 (GRCm39) E555G probably damaging Het
Rb1cc1 G A 1: 6,315,395 (GRCm39) V457M probably damaging Het
Rbp3 A G 14: 33,676,522 (GRCm39) R157G probably benign Het
Rin3 T G 12: 102,335,857 (GRCm39) H589Q probably benign Het
Scart2 A C 7: 139,828,913 (GRCm39) T191P possibly damaging Het
Sgk2 T A 2: 162,854,890 (GRCm39) S334T probably damaging Het
Sh2d4b T C 14: 40,614,832 (GRCm39) M31V probably benign Het
Slc23a3 G A 1: 75,106,271 (GRCm39) T316I probably damaging Het
Slc5a4b C A 10: 75,910,925 (GRCm39) G304C probably damaging Het
Slc7a14 A G 3: 31,311,759 (GRCm39) V87A probably damaging Het
Slitrk3 A T 3: 72,956,164 (GRCm39) N869K probably benign Het
St8sia6 T C 2: 13,661,896 (GRCm39) R312G possibly damaging Het
Strip2 A T 6: 29,923,968 (GRCm39) E94V probably benign Het
Sycp2 T C 2: 177,990,052 (GRCm39) D1398G probably damaging Het
Syne1 C A 10: 5,143,040 (GRCm39) V114F possibly damaging Het
Syne1 T C 10: 5,280,204 (GRCm39) K1630E probably benign Het
Sytl2 A G 7: 90,025,334 (GRCm39) N441D probably benign Het
Thsd7a A G 6: 12,501,136 (GRCm39) C424R Het
Tln2 T C 9: 67,302,827 (GRCm39) D48G probably damaging Het
Treml1 A G 17: 48,673,852 (GRCm39) T288A probably damaging Het
Ttn T C 2: 76,596,113 (GRCm39) I20267V probably benign Het
Ttn A T 2: 76,679,259 (GRCm39) V10821D unknown Het
Vmn2r111 A C 17: 22,767,011 (GRCm39) S829A probably benign Het
Xcl1 T A 1: 164,763,079 (GRCm39) probably benign Het
Zdhhc23 A T 16: 43,794,227 (GRCm39) V149E probably damaging Het
Zfp273 A T 13: 67,970,387 (GRCm39) I12F possibly damaging Het
Zfp874a A T 13: 67,590,764 (GRCm39) C307S probably damaging Het
Other mutations in Hipk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Hipk3 APN 2 104,260,576 (GRCm39) missense possibly damaging 0.52
IGL00937:Hipk3 APN 2 104,263,517 (GRCm39) missense possibly damaging 0.82
IGL01719:Hipk3 APN 2 104,267,434 (GRCm39) missense possibly damaging 0.78
IGL01802:Hipk3 APN 2 104,302,198 (GRCm39) splice site probably benign
IGL01932:Hipk3 APN 2 104,301,326 (GRCm39) missense probably damaging 1.00
IGL02089:Hipk3 APN 2 104,261,724 (GRCm39) missense probably damaging 1.00
IGL02522:Hipk3 APN 2 104,301,676 (GRCm39) missense probably damaging 1.00
IGL02525:Hipk3 APN 2 104,301,757 (GRCm39) missense probably damaging 1.00
IGL02959:Hipk3 APN 2 104,301,604 (GRCm39) missense probably damaging 1.00
IGL02986:Hipk3 APN 2 104,264,086 (GRCm39) missense probably damaging 1.00
R0136:Hipk3 UTSW 2 104,269,638 (GRCm39) missense probably benign 0.02
R0277:Hipk3 UTSW 2 104,271,593 (GRCm39) missense probably damaging 1.00
R0308:Hipk3 UTSW 2 104,263,552 (GRCm39) missense probably damaging 0.99
R0367:Hipk3 UTSW 2 104,261,594 (GRCm39) nonsense probably null
R0597:Hipk3 UTSW 2 104,263,982 (GRCm39) missense possibly damaging 0.94
R1079:Hipk3 UTSW 2 104,302,043 (GRCm39) missense probably benign 0.00
R1171:Hipk3 UTSW 2 104,302,021 (GRCm39) missense probably benign 0.02
R1244:Hipk3 UTSW 2 104,263,601 (GRCm39) missense probably damaging 1.00
R1509:Hipk3 UTSW 2 104,271,607 (GRCm39) missense probably benign 0.01
R1616:Hipk3 UTSW 2 104,264,090 (GRCm39) nonsense probably null
R1893:Hipk3 UTSW 2 104,263,601 (GRCm39) missense probably damaging 1.00
R1938:Hipk3 UTSW 2 104,260,533 (GRCm39) missense possibly damaging 0.89
R1969:Hipk3 UTSW 2 104,264,186 (GRCm39) missense probably damaging 1.00
R1975:Hipk3 UTSW 2 104,301,518 (GRCm39) missense probably benign 0.00
R1985:Hipk3 UTSW 2 104,264,780 (GRCm39) missense probably benign 0.16
R2105:Hipk3 UTSW 2 104,269,737 (GRCm39) missense probably damaging 0.97
R2422:Hipk3 UTSW 2 104,301,830 (GRCm39) missense probably benign 0.01
R3028:Hipk3 UTSW 2 104,264,135 (GRCm39) missense probably benign
R3747:Hipk3 UTSW 2 104,271,628 (GRCm39) nonsense probably null
R3923:Hipk3 UTSW 2 104,301,107 (GRCm39) missense probably damaging 1.00
R4320:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4321:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4322:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4323:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4324:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4595:Hipk3 UTSW 2 104,271,622 (GRCm39) missense probably benign 0.01
R4604:Hipk3 UTSW 2 104,269,674 (GRCm39) missense probably damaging 1.00
R4657:Hipk3 UTSW 2 104,264,104 (GRCm39) missense probably benign 0.00
R5193:Hipk3 UTSW 2 104,260,345 (GRCm39) missense possibly damaging 0.94
R5769:Hipk3 UTSW 2 104,265,298 (GRCm39) missense possibly damaging 0.69
R5843:Hipk3 UTSW 2 104,270,569 (GRCm39) missense possibly damaging 0.65
R5906:Hipk3 UTSW 2 104,302,153 (GRCm39) missense probably damaging 1.00
R5976:Hipk3 UTSW 2 104,301,529 (GRCm39) missense probably damaging 1.00
R5991:Hipk3 UTSW 2 104,268,328 (GRCm39) missense probably damaging 1.00
R6214:Hipk3 UTSW 2 104,264,086 (GRCm39) missense probably damaging 1.00
R6215:Hipk3 UTSW 2 104,264,086 (GRCm39) missense probably damaging 1.00
R6285:Hipk3 UTSW 2 104,301,770 (GRCm39) missense probably damaging 1.00
R6523:Hipk3 UTSW 2 104,269,753 (GRCm39) missense possibly damaging 0.50
R6713:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R7381:Hipk3 UTSW 2 104,269,696 (GRCm39) missense probably damaging 0.99
R7517:Hipk3 UTSW 2 104,265,059 (GRCm39) missense probably benign 0.00
R8780:Hipk3 UTSW 2 104,264,179 (GRCm39) missense probably damaging 0.99
R9186:Hipk3 UTSW 2 104,301,439 (GRCm39) missense probably damaging 1.00
R9187:Hipk3 UTSW 2 104,276,936 (GRCm39) missense probably damaging 1.00
R9374:Hipk3 UTSW 2 104,301,850 (GRCm39) missense probably benign
R9398:Hipk3 UTSW 2 104,263,562 (GRCm39) missense probably benign 0.01
R9552:Hipk3 UTSW 2 104,301,850 (GRCm39) missense probably benign
R9584:Hipk3 UTSW 2 104,301,910 (GRCm39) missense probably benign 0.01
R9641:Hipk3 UTSW 2 104,267,376 (GRCm39) missense probably benign
X0021:Hipk3 UTSW 2 104,271,711 (GRCm39) critical splice acceptor site probably null
Z1088:Hipk3 UTSW 2 104,264,974 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTAACAGGACACAGCAG -3'
(R):5'- TGTGTAACACTGCTTTGGTCTC -3'

Sequencing Primer
(F):5'- AGCCACAGTGTGCTTGCTAC -3'
(R):5'- GTCTCCGAGTTCATGTGA -3'
Posted On 2021-07-15