Incidental Mutation 'R8843:Slc7a14'
ID674518
Institutional Source Beutler Lab
Gene Symbol Slc7a14
Ensembl Gene ENSMUSG00000069072
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 14
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R8843 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location31202858-31310378 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31257610 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 87 (V87A)
Ref Sequence ENSEMBL: ENSMUSP00000103880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091259] [ENSMUST00000108245]
Predicted Effect probably damaging
Transcript: ENSMUST00000091259
AA Change: V87A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088803
Gene: ENSMUSG00000069072
AA Change: V87A

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 443 2.1e-44 PFAM
Pfam:AA_permease 57 436 7.2e-38 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 677 9.2e-21 PFAM
low complexity region 737 757 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108245
AA Change: V87A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103880
Gene: ENSMUSG00000069072
AA Change: V87A

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 445 2.5e-46 PFAM
Pfam:AA_permease 57 437 6.9e-41 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 668 1.4e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye electrophysiology, thin retinal outer nuclear and decreased total retinal thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A C 7: 140,249,000 T191P possibly damaging Het
AB124611 C G 9: 21,529,035 Q106E probably benign Het
Abi2 A G 1: 60,453,729 M387V probably null Het
Adra2c A T 5: 35,280,363 N160Y probably damaging Het
Ager G A 17: 34,600,742 R383H probably benign Het
Arhgef28 C T 13: 97,994,049 R427H probably benign Het
Atl1 T A 12: 69,926,148 S81T probably damaging Het
Cdh10 T A 15: 19,013,401 F696I possibly damaging Het
Cdk2ap2 T C 19: 4,097,429 S2P unknown Het
Cela1 G A 15: 100,682,940 T145I probably benign Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Col22a1 A G 15: 72,006,654 I218T probably damaging Het
Copb1 T C 7: 114,221,700 I785V possibly damaging Het
Dnajc16 A T 4: 141,764,691 V607E possibly damaging Het
Dnali1 A T 4: 125,063,621 L110Q probably damaging Het
Epn1 A G 7: 5,093,376 E223G probably benign Het
Erbb3 A G 10: 128,578,456 L473P possibly damaging Het
Fam160a1 A G 3: 85,661,011 I1067T possibly damaging Het
Gadl1 T A 9: 116,006,501 D332E probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Heg1 A G 16: 33,750,493 S1188G probably null Het
Hipk3 G A 2: 104,437,897 A575V probably benign Het
Htt T A 5: 34,889,465 I2375N possibly damaging Het
Klhl24 A T 16: 20,120,230 K512* probably null Het
Krtdap A T 7: 30,789,527 Y40F probably damaging Het
Lhx1 A T 11: 84,519,629 S381T probably benign Het
Lnpep G A 17: 17,552,941 P655L probably damaging Het
Map6d1 A G 16: 20,236,636 V150A probably benign Het
March10 A G 11: 105,401,976 S202P possibly damaging Het
Med1 A C 11: 98,189,276 L13R possibly damaging Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Myh7 T G 14: 54,975,295 D1431A probably damaging Het
Myo3b G T 2: 70,257,981 G863W probably damaging Het
Nat8f1 G T 6: 85,910,925 Q18K probably benign Het
Ncaph A G 2: 127,108,609 V576A probably benign Het
Nfkbia T G 12: 55,492,411 D39A possibly damaging Het
Nrxn2 G T 19: 6,505,027 G1179C probably damaging Het
Olfr361 A C 2: 37,085,295 V151G probably damaging Het
P4ha1 A G 10: 59,369,633 D495G probably damaging Het
Phf20 C T 2: 156,302,923 A817V probably benign Het
Phlpp2 A T 8: 109,925,799 I592F probably benign Het
Polq A G 16: 37,011,918 S7G unknown Het
Ppfia3 G T 7: 45,348,517 Q729K probably benign Het
Prmt8 A C 6: 127,729,499 F110V probably damaging Het
Psca A T 15: 74,716,019 probably null Het
Pus7 G T 5: 23,775,756 D165E probably benign Het
Raver2 A G 4: 101,137,745 E555G probably damaging Het
Rb1cc1 G A 1: 6,245,171 V457M probably damaging Het
Rbp3 A G 14: 33,954,565 R157G probably benign Het
Rin3 T G 12: 102,369,598 H589Q probably benign Het
Sgk2 T A 2: 163,012,970 S334T probably damaging Het
Sh2d4b T C 14: 40,892,875 M31V probably benign Het
Slc23a3 G A 1: 75,129,627 T316I probably damaging Het
Slc5a4b C A 10: 76,075,091 G304C probably damaging Het
Slitrk3 A T 3: 73,048,831 N869K probably benign Het
St8sia6 T C 2: 13,657,085 R312G possibly damaging Het
Strip2 A T 6: 29,923,969 E94V probably benign Het
Sycp2 T C 2: 178,348,259 D1398G probably damaging Het
Syne1 C A 10: 5,193,040 V114F possibly damaging Het
Syne1 T C 10: 5,330,204 K1630E probably benign Het
Sytl2 A G 7: 90,376,126 N441D probably benign Het
Thsd7a A G 6: 12,501,137 C424R Het
Tln2 T C 9: 67,395,545 D48G probably damaging Het
Treml1 A G 17: 48,366,824 T288A probably damaging Het
Ttn T C 2: 76,765,769 I20267V probably benign Het
Ttn A T 2: 76,848,915 V10821D unknown Het
Vmn2r111 A C 17: 22,548,030 S829A probably benign Het
Xcl1 T A 1: 164,935,510 probably benign Het
Zdhhc23 A T 16: 43,973,864 V149E probably damaging Het
Zfp273 A T 13: 67,822,268 I12F possibly damaging Het
Zfp874a A T 13: 67,442,645 C307S probably damaging Het
Other mutations in Slc7a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Slc7a14 APN 3 31238678 missense probably damaging 1.00
IGL02713:Slc7a14 APN 3 31257763 missense probably damaging 0.96
IGL03341:Slc7a14 APN 3 31238770 missense probably damaging 1.00
IGL03350:Slc7a14 APN 3 31237409 missense probably benign 0.35
IGL03379:Slc7a14 APN 3 31223515 missense probably damaging 1.00
R0064:Slc7a14 UTSW 3 31227060 missense probably damaging 1.00
R1549:Slc7a14 UTSW 3 31224118 missense possibly damaging 0.94
R1591:Slc7a14 UTSW 3 31237449 missense probably damaging 1.00
R2054:Slc7a14 UTSW 3 31237362 splice site probably benign
R2057:Slc7a14 UTSW 3 31237496 missense probably damaging 1.00
R2442:Slc7a14 UTSW 3 31230320 missense probably damaging 1.00
R2504:Slc7a14 UTSW 3 31237501 missense possibly damaging 0.85
R3848:Slc7a14 UTSW 3 31237474 missense probably damaging 1.00
R4653:Slc7a14 UTSW 3 31257682 missense probably damaging 1.00
R4702:Slc7a14 UTSW 3 31230398 missense probably damaging 1.00
R5043:Slc7a14 UTSW 3 31237466 missense probably damaging 1.00
R5187:Slc7a14 UTSW 3 31237365 splice site probably null
R5345:Slc7a14 UTSW 3 31223857 missense probably damaging 0.99
R5393:Slc7a14 UTSW 3 31257770 missense probably damaging 1.00
R5421:Slc7a14 UTSW 3 31224197 missense probably damaging 1.00
R5736:Slc7a14 UTSW 3 31223910 missense probably benign 0.00
R5771:Slc7a14 UTSW 3 31238707 missense probably damaging 1.00
R5896:Slc7a14 UTSW 3 31257570 missense probably damaging 1.00
R5996:Slc7a14 UTSW 3 31209236 missense probably benign
R6020:Slc7a14 UTSW 3 31224112 missense probably benign
R6107:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R6140:Slc7a14 UTSW 3 31237548 missense probably benign
R6491:Slc7a14 UTSW 3 31223944 missense probably damaging 1.00
R6846:Slc7a14 UTSW 3 31224223 missense probably damaging 1.00
R6990:Slc7a14 UTSW 3 31223579 missense possibly damaging 0.90
R7184:Slc7a14 UTSW 3 31227063 missense probably damaging 0.98
R7271:Slc7a14 UTSW 3 31224235 missense probably damaging 1.00
R7282:Slc7a14 UTSW 3 31227153 missense possibly damaging 0.67
R7331:Slc7a14 UTSW 3 31257731 missense probably benign 0.00
R8227:Slc7a14 UTSW 3 31209212 missense probably benign 0.00
R8238:Slc7a14 UTSW 3 31227151 missense probably benign 0.01
R8524:Slc7a14 UTSW 3 31224133 missense possibly damaging 0.70
R8903:Slc7a14 UTSW 3 31223446 missense probably damaging 0.98
Z1088:Slc7a14 UTSW 3 31223999 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACAGGACAGAATTGAATTGCAC -3'
(R):5'- CAAACCAGTGGAGTCCATGC -3'

Sequencing Primer
(F):5'- TGCACAAATTGTCCTCAGGTAC -3'
(R):5'- TCCATGCTGGAGGGAACTG -3'
Posted On2021-07-15