Incidental Mutation 'R8843:Dnajc16'
ID 674523
Institutional Source Beutler Lab
Gene Symbol Dnajc16
Ensembl Gene ENSMUSG00000040697
Gene Name DnaJ heat shock protein family (Hsp40) member C16
Synonyms 4732437J24Rik, 2900037O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock # R8843 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 141760189-141790931 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 141764691 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 607 (V607E)
Ref Sequence ENSEMBL: ENSMUSP00000048714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038014]
AlphaFold Q80TN4
PDB Structure Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038014
AA Change: V607E

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: V607E

DomainStartEndE-ValueType
DnaJ 28 85 4.5e-30 SMART
Pfam:Thioredoxin 142 243 4.4e-8 PFAM
low complexity region 537 549 N/A INTRINSIC
low complexity region 730 750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A C 7: 140,249,000 T191P possibly damaging Het
AB124611 C G 9: 21,529,035 Q106E probably benign Het
Abi2 A G 1: 60,453,729 M387V probably null Het
Adra2c A T 5: 35,280,363 N160Y probably damaging Het
Ager G A 17: 34,600,742 R383H probably benign Het
Arhgef28 C T 13: 97,994,049 R427H probably benign Het
Atl1 T A 12: 69,926,148 S81T probably damaging Het
Ccdc80 T A 16: 45,127,107 probably benign Het
Cdh10 T A 15: 19,013,401 F696I possibly damaging Het
Cdk2ap2 T C 19: 4,097,429 S2P unknown Het
Cela1 G A 15: 100,682,940 T145I probably benign Het
Celsr2 A T 3: 108,396,127 probably benign Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Col22a1 A G 15: 72,006,654 I218T probably damaging Het
Copb1 T C 7: 114,221,700 I785V possibly damaging Het
Dnali1 A T 4: 125,063,621 L110Q probably damaging Het
Epn1 A G 7: 5,093,376 E223G probably benign Het
Erbb3 A G 10: 128,578,456 L473P possibly damaging Het
Fam160a1 A G 3: 85,661,011 I1067T possibly damaging Het
Gadl1 T A 9: 116,006,501 D332E probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Heg1 A G 16: 33,750,493 S1188G probably null Het
Hipk3 G A 2: 104,437,897 A575V probably benign Het
Htt T A 5: 34,889,465 I2375N possibly damaging Het
Klhl24 A T 16: 20,120,230 K512* probably null Het
Krtdap A T 7: 30,789,527 Y40F probably damaging Het
Lhx1 A T 11: 84,519,629 S381T probably benign Het
Lnpep G A 17: 17,552,941 P655L probably damaging Het
Map6d1 A G 16: 20,236,636 V150A probably benign Het
March10 A G 11: 105,401,976 S202P possibly damaging Het
Med1 A C 11: 98,189,276 L13R possibly damaging Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Myh7 T G 14: 54,975,295 D1431A probably damaging Het
Myo3b G T 2: 70,257,981 G863W probably damaging Het
Nat8f1 G T 6: 85,910,925 Q18K probably benign Het
Ncaph A G 2: 127,108,609 V576A probably benign Het
Nfkbia T G 12: 55,492,411 D39A possibly damaging Het
Nrxn2 G T 19: 6,505,027 G1179C probably damaging Het
Olfr361 A C 2: 37,085,295 V151G probably damaging Het
P4ha1 A G 10: 59,369,633 D495G probably damaging Het
Phf20 C T 2: 156,302,923 A817V probably benign Het
Phlpp2 A T 8: 109,925,799 I592F probably benign Het
Polq A G 16: 37,011,918 S7G unknown Het
Ppfia3 G T 7: 45,348,517 Q729K probably benign Het
Prmt8 A C 6: 127,729,499 F110V probably damaging Het
Psca A T 15: 74,716,019 probably null Het
Pus7 G T 5: 23,775,756 D165E probably benign Het
Raver2 A G 4: 101,137,745 E555G probably damaging Het
Rb1cc1 G A 1: 6,245,171 V457M probably damaging Het
Rbp3 A G 14: 33,954,565 R157G probably benign Het
Rin3 T G 12: 102,369,598 H589Q probably benign Het
Sgk2 T A 2: 163,012,970 S334T probably damaging Het
Sh2d4b T C 14: 40,892,875 M31V probably benign Het
Slc23a3 G A 1: 75,129,627 T316I probably damaging Het
Slc5a4b C A 10: 76,075,091 G304C probably damaging Het
Slc7a14 A G 3: 31,257,610 V87A probably damaging Het
Slitrk3 A T 3: 73,048,831 N869K probably benign Het
St8sia6 T C 2: 13,657,085 R312G possibly damaging Het
Strip2 A T 6: 29,923,969 E94V probably benign Het
Sycp2 T C 2: 178,348,259 D1398G probably damaging Het
Syne1 C A 10: 5,193,040 V114F possibly damaging Het
Syne1 T C 10: 5,330,204 K1630E probably benign Het
Sytl2 A G 7: 90,376,126 N441D probably benign Het
Thsd7a A G 6: 12,501,137 C424R Het
Tln2 T C 9: 67,395,545 D48G probably damaging Het
Treml1 A G 17: 48,366,824 T288A probably damaging Het
Ttn T C 2: 76,765,769 I20267V probably benign Het
Ttn A T 2: 76,848,915 V10821D unknown Het
Vmn2r111 A C 17: 22,548,030 S829A probably benign Het
Xcl1 T A 1: 164,935,510 probably benign Het
Zdhhc23 A T 16: 43,973,864 V149E probably damaging Het
Zfp273 A T 13: 67,822,268 I12F possibly damaging Het
Zfp874a A T 13: 67,442,645 C307S probably damaging Het
Other mutations in Dnajc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dnajc16 APN 4 141763563 splice site probably null
IGL00840:Dnajc16 APN 4 141768003 missense probably damaging 1.00
IGL01503:Dnajc16 APN 4 141763697 missense possibly damaging 0.65
IGL01919:Dnajc16 APN 4 141774629 missense probably benign 0.06
IGL02065:Dnajc16 APN 4 141776933 missense probably damaging 1.00
IGL02544:Dnajc16 APN 4 141764647 missense probably damaging 1.00
IGL03028:Dnajc16 APN 4 141767732 nonsense probably null
PIT4418001:Dnajc16 UTSW 4 141770949 missense probably damaging 0.99
PIT4585001:Dnajc16 UTSW 4 141764685 missense probably damaging 1.00
R0071:Dnajc16 UTSW 4 141768007 missense probably benign
R0415:Dnajc16 UTSW 4 141789048 nonsense probably null
R0532:Dnajc16 UTSW 4 141789009 missense probably damaging 1.00
R1418:Dnajc16 UTSW 4 141767741 nonsense probably null
R2959:Dnajc16 UTSW 4 141766545 nonsense probably null
R3025:Dnajc16 UTSW 4 141774611 missense probably benign
R3796:Dnajc16 UTSW 4 141767737 missense probably benign
R3854:Dnajc16 UTSW 4 141763653 nonsense probably null
R3856:Dnajc16 UTSW 4 141763653 nonsense probably null
R4661:Dnajc16 UTSW 4 141763548 missense probably damaging 1.00
R4841:Dnajc16 UTSW 4 141774625 missense probably damaging 1.00
R4842:Dnajc16 UTSW 4 141774625 missense probably damaging 1.00
R5116:Dnajc16 UTSW 4 141767969 nonsense probably null
R5126:Dnajc16 UTSW 4 141774509 missense probably benign 0.01
R5140:Dnajc16 UTSW 4 141764683 missense possibly damaging 0.85
R5275:Dnajc16 UTSW 4 141767928 missense possibly damaging 0.82
R5295:Dnajc16 UTSW 4 141767928 missense possibly damaging 0.82
R5891:Dnajc16 UTSW 4 141775392 missense probably benign
R6888:Dnajc16 UTSW 4 141776992 missense probably benign 0.24
R7062:Dnajc16 UTSW 4 141766690 missense probably damaging 1.00
R7441:Dnajc16 UTSW 4 141763813 missense probably damaging 1.00
R7684:Dnajc16 UTSW 4 141774568 missense probably benign 0.02
R8924:Dnajc16 UTSW 4 141766707 nonsense probably null
R9005:Dnajc16 UTSW 4 141764634 missense possibly damaging 0.95
R9053:Dnajc16 UTSW 4 141783060 missense probably benign 0.28
R9550:Dnajc16 UTSW 4 141767747 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCAAGTGGAGAGTCCTCTTC -3'
(R):5'- AGGCGCTCTCAGATTCACTG -3'

Sequencing Primer
(F):5'- AAGTGGAGAGTCCTCTTCTTCCTTAG -3'
(R):5'- CCCACATAATTGAGGCTTGCCTTAAG -3'
Posted On 2021-07-15