Incidental Mutation 'R8843:Slc5a4b'
ID 674545
Institutional Source Beutler Lab
Gene Symbol Slc5a4b
Ensembl Gene ENSMUSG00000020226
Gene Name solute carrier family 5 (neutral amino acid transporters, system A), member 4b
Synonyms pSGLT2, SGLT3b, 2010104G07Rik, SAAT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock # R8843 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 76057494-76110961 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 76075091 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 304 (G304C)
Ref Sequence ENSEMBL: ENSMUSP00000113582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120757]
AlphaFold Q91ZP4
Predicted Effect probably damaging
Transcript: ENSMUST00000120757
AA Change: G304C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113582
Gene: ENSMUSG00000020226
AA Change: G304C

DomainStartEndE-ValueType
low complexity region 16 21 N/A INTRINSIC
Pfam:SSF 58 492 1.4e-163 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 640 659 N/A INTRINSIC
Meta Mutation Damage Score 0.3033 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A C 7: 140,249,000 T191P possibly damaging Het
AB124611 C G 9: 21,529,035 Q106E probably benign Het
Abi2 A G 1: 60,453,729 M387V probably null Het
Adra2c A T 5: 35,280,363 N160Y probably damaging Het
Ager G A 17: 34,600,742 R383H probably benign Het
Arhgef28 C T 13: 97,994,049 R427H probably benign Het
Atl1 T A 12: 69,926,148 S81T probably damaging Het
Ccdc80 T A 16: 45,127,107 probably benign Het
Cdh10 T A 15: 19,013,401 F696I possibly damaging Het
Cdk2ap2 T C 19: 4,097,429 S2P unknown Het
Cela1 G A 15: 100,682,940 T145I probably benign Het
Celsr2 A T 3: 108,396,127 probably benign Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Col22a1 A G 15: 72,006,654 I218T probably damaging Het
Copb1 T C 7: 114,221,700 I785V possibly damaging Het
Dnajc16 A T 4: 141,764,691 V607E possibly damaging Het
Dnali1 A T 4: 125,063,621 L110Q probably damaging Het
Epn1 A G 7: 5,093,376 E223G probably benign Het
Erbb3 A G 10: 128,578,456 L473P possibly damaging Het
Fam160a1 A G 3: 85,661,011 I1067T possibly damaging Het
Gadl1 T A 9: 116,006,501 D332E probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Heg1 A G 16: 33,750,493 S1188G probably null Het
Hipk3 G A 2: 104,437,897 A575V probably benign Het
Htt T A 5: 34,889,465 I2375N possibly damaging Het
Klhl24 A T 16: 20,120,230 K512* probably null Het
Krtdap A T 7: 30,789,527 Y40F probably damaging Het
Lhx1 A T 11: 84,519,629 S381T probably benign Het
Lnpep G A 17: 17,552,941 P655L probably damaging Het
Map6d1 A G 16: 20,236,636 V150A probably benign Het
March10 A G 11: 105,401,976 S202P possibly damaging Het
Med1 A C 11: 98,189,276 L13R possibly damaging Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Myh7 T G 14: 54,975,295 D1431A probably damaging Het
Myo3b G T 2: 70,257,981 G863W probably damaging Het
Nat8f1 G T 6: 85,910,925 Q18K probably benign Het
Ncaph A G 2: 127,108,609 V576A probably benign Het
Nfkbia T G 12: 55,492,411 D39A possibly damaging Het
Nrxn2 G T 19: 6,505,027 G1179C probably damaging Het
Olfr361 A C 2: 37,085,295 V151G probably damaging Het
P4ha1 A G 10: 59,369,633 D495G probably damaging Het
Phf20 C T 2: 156,302,923 A817V probably benign Het
Phlpp2 A T 8: 109,925,799 I592F probably benign Het
Polq A G 16: 37,011,918 S7G unknown Het
Ppfia3 G T 7: 45,348,517 Q729K probably benign Het
Prmt8 A C 6: 127,729,499 F110V probably damaging Het
Psca A T 15: 74,716,019 probably null Het
Pus7 G T 5: 23,775,756 D165E probably benign Het
Raver2 A G 4: 101,137,745 E555G probably damaging Het
Rb1cc1 G A 1: 6,245,171 V457M probably damaging Het
Rbp3 A G 14: 33,954,565 R157G probably benign Het
Rin3 T G 12: 102,369,598 H589Q probably benign Het
Sgk2 T A 2: 163,012,970 S334T probably damaging Het
Sh2d4b T C 14: 40,892,875 M31V probably benign Het
Slc23a3 G A 1: 75,129,627 T316I probably damaging Het
Slc7a14 A G 3: 31,257,610 V87A probably damaging Het
Slitrk3 A T 3: 73,048,831 N869K probably benign Het
St8sia6 T C 2: 13,657,085 R312G possibly damaging Het
Strip2 A T 6: 29,923,969 E94V probably benign Het
Sycp2 T C 2: 178,348,259 D1398G probably damaging Het
Syne1 C A 10: 5,193,040 V114F possibly damaging Het
Syne1 T C 10: 5,330,204 K1630E probably benign Het
Sytl2 A G 7: 90,376,126 N441D probably benign Het
Thsd7a A G 6: 12,501,137 C424R Het
Tln2 T C 9: 67,395,545 D48G probably damaging Het
Treml1 A G 17: 48,366,824 T288A probably damaging Het
Ttn T C 2: 76,765,769 I20267V probably benign Het
Ttn A T 2: 76,848,915 V10821D unknown Het
Vmn2r111 A C 17: 22,548,030 S829A probably benign Het
Xcl1 T A 1: 164,935,510 probably benign Het
Zdhhc23 A T 16: 43,973,864 V149E probably damaging Het
Zfp273 A T 13: 67,822,268 I12F possibly damaging Het
Zfp874a A T 13: 67,442,645 C307S probably damaging Het
Other mutations in Slc5a4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Slc5a4b APN 10 76070588 missense probably damaging 1.00
IGL01433:Slc5a4b APN 10 76070495 splice site probably benign
IGL01754:Slc5a4b APN 10 76070615 missense probably damaging 1.00
IGL01904:Slc5a4b APN 10 76060426 missense probably damaging 0.98
IGL01990:Slc5a4b APN 10 76060354 missense probably benign 0.01
IGL02211:Slc5a4b APN 10 76060463 splice site probably benign
IGL02254:Slc5a4b APN 10 76060430 missense probably benign
IGL02389:Slc5a4b APN 10 76072465 nonsense probably null
IGL02427:Slc5a4b APN 10 76058879 missense possibly damaging 0.47
IGL02493:Slc5a4b APN 10 76075015 missense probably damaging 1.00
IGL02554:Slc5a4b APN 10 76110851 missense possibly damaging 0.75
IGL02670:Slc5a4b APN 10 76075100 missense probably damaging 1.00
R0254:Slc5a4b UTSW 10 76070628 missense possibly damaging 0.55
R0285:Slc5a4b UTSW 10 76062283 missense probably damaging 0.99
R0294:Slc5a4b UTSW 10 76081327 missense probably damaging 1.00
R0522:Slc5a4b UTSW 10 76090700 missense probably damaging 0.99
R0601:Slc5a4b UTSW 10 76064036 missense possibly damaging 0.81
R0714:Slc5a4b UTSW 10 76081507 missense probably benign 0.09
R0975:Slc5a4b UTSW 10 76081407 missense probably benign 0.09
R1934:Slc5a4b UTSW 10 76081473 missense possibly damaging 0.51
R2339:Slc5a4b UTSW 10 76108549 missense probably damaging 1.00
R2886:Slc5a4b UTSW 10 76075073 missense probably damaging 0.98
R3552:Slc5a4b UTSW 10 76081524 missense probably damaging 0.99
R3890:Slc5a4b UTSW 10 76062260 missense probably benign 0.01
R4012:Slc5a4b UTSW 10 76074992 missense probably damaging 1.00
R4259:Slc5a4b UTSW 10 76103852 missense probably damaging 1.00
R4260:Slc5a4b UTSW 10 76103852 missense probably damaging 1.00
R4471:Slc5a4b UTSW 10 76058891 nonsense probably null
R4667:Slc5a4b UTSW 10 76075045 missense possibly damaging 0.78
R4846:Slc5a4b UTSW 10 76062239 missense probably damaging 0.99
R4939:Slc5a4b UTSW 10 76081467 missense probably benign 0.44
R5181:Slc5a4b UTSW 10 76060387 nonsense probably null
R5319:Slc5a4b UTSW 10 76062399 missense probably benign 0.08
R6306:Slc5a4b UTSW 10 76081351 missense probably benign 0.01
R6422:Slc5a4b UTSW 10 76103862 missense probably damaging 0.97
R6837:Slc5a4b UTSW 10 76062386 missense possibly damaging 0.49
R6997:Slc5a4b UTSW 10 76089978 missense probably damaging 0.97
R7140:Slc5a4b UTSW 10 76075109 missense probably damaging 1.00
R7527:Slc5a4b UTSW 10 76110908 missense probably benign 0.01
R7683:Slc5a4b UTSW 10 76064072 missense probably damaging 0.96
R7718:Slc5a4b UTSW 10 76070573 missense probably damaging 1.00
R7794:Slc5a4b UTSW 10 76062299 missense probably benign 0.19
R7877:Slc5a4b UTSW 10 76075052 missense probably damaging 1.00
R8150:Slc5a4b UTSW 10 76103846 missense possibly damaging 0.93
R9111:Slc5a4b UTSW 10 76089993 splice site probably benign
R9163:Slc5a4b UTSW 10 76081331 nonsense probably null
R9195:Slc5a4b UTSW 10 76062315 missense probably damaging 1.00
R9600:Slc5a4b UTSW 10 76060405 missense probably damaging 1.00
R9643:Slc5a4b UTSW 10 76110062 missense probably benign 0.01
R9656:Slc5a4b UTSW 10 76108557 missense probably damaging 0.98
R9699:Slc5a4b UTSW 10 76110840 missense probably damaging 0.99
X0019:Slc5a4b UTSW 10 76110851 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TCTGGTGGGTCTGAAGACAG -3'
(R):5'- ACTGGTTTCCACTAGCCATACC -3'

Sequencing Primer
(F):5'- TCTGAAGACAGTGACAGTGTACTC -3'
(R):5'- CCCTGTGTCCATGGAGATCAAAAG -3'
Posted On 2021-07-15