Incidental Mutation 'R8843:Erbb3'
ID674546
Institutional Source Beutler Lab
Gene Symbol Erbb3
Ensembl Gene ENSMUSG00000018166
Gene Nameerb-b2 receptor tyrosine kinase 3
SynonymsErbb-3, Erbb3r, HER3
Accession Numbers

Ncbi RefSeq: NM_010153.1; MGI:95411

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8843 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location128567523-128589652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128578456 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 473 (L473P)
Ref Sequence ENSEMBL: ENSMUSP00000080716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082059]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082059
AA Change: L473P

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080716
Gene: ENSMUSG00000018166
AA Change: L473P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 2.4e-31 PFAM
FU 180 220 5.83e0 SMART
FU 223 265 7.63e-10 SMART
Pfam:Recep_L_domain 353 474 7.5e-33 PFAM
FU 490 541 7.82e-7 SMART
FU 546 595 1.34e-5 SMART
FU 607 643 9.24e0 SMART
TyrKc 707 963 7.42e-91 SMART
low complexity region 997 1018 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1135 1148 N/A INTRINSIC
low complexity region 1172 1185 N/A INTRINSIC
low complexity region 1186 1196 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype Strain: 3513098; 1929072; 1928828; 1929598
Lethality: E10-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound protein has a neuregulin binding domain but not an active kinase domain. It therefore can bind this ligand but not convey the signal into the cell through protein phosphorylation. However, it does form heterodimers with other EGF receptor family members which do have kinase activity. Heterodimerization leads to the activation of pathways which lead to cell proliferation or differentiation. Amplification of this gene and/or overexpression of its protein have been reported in numerous cancers, including prostate, bladder, and breast tumors. Alternate transcriptional splice variants encoding different isoforms have been characterized. One isoform lacks the intermembrane region and is secreted outside the cell. This form acts to modulate the activity of the membrane-bound form. Additional splice variants have also been reported, but they have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a lack of Schwann-cell precursors leading to loss of sensory and motor neurons, hypoplasia of the primary sympathetic ganglion chain, cardiac defects, impaired brain development, and embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(27) : Targeted(11) Gene trapped(14) Chemically induced(2)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A C 7: 140,249,000 T191P possibly damaging Het
AB124611 C G 9: 21,529,035 Q106E probably benign Het
Abi2 A G 1: 60,453,729 M387V probably null Het
Adra2c A T 5: 35,280,363 N160Y probably damaging Het
Ager G A 17: 34,600,742 R383H probably benign Het
Arhgef28 C T 13: 97,994,049 R427H probably benign Het
Atl1 T A 12: 69,926,148 S81T probably damaging Het
Cdh10 T A 15: 19,013,401 F696I possibly damaging Het
Cdk2ap2 T C 19: 4,097,429 S2P unknown Het
Cela1 G A 15: 100,682,940 T145I probably benign Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Col22a1 A G 15: 72,006,654 I218T probably damaging Het
Copb1 T C 7: 114,221,700 I785V possibly damaging Het
Dnajc16 A T 4: 141,764,691 V607E possibly damaging Het
Dnali1 A T 4: 125,063,621 L110Q probably damaging Het
Epn1 A G 7: 5,093,376 E223G probably benign Het
Fam160a1 A G 3: 85,661,011 I1067T possibly damaging Het
Gadl1 T A 9: 116,006,501 D332E probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Heg1 A G 16: 33,750,493 S1188G probably null Het
Hipk3 G A 2: 104,437,897 A575V probably benign Het
Htt T A 5: 34,889,465 I2375N possibly damaging Het
Klhl24 A T 16: 20,120,230 K512* probably null Het
Krtdap A T 7: 30,789,527 Y40F probably damaging Het
Lhx1 A T 11: 84,519,629 S381T probably benign Het
Lnpep G A 17: 17,552,941 P655L probably damaging Het
Map6d1 A G 16: 20,236,636 V150A probably benign Het
March10 A G 11: 105,401,976 S202P possibly damaging Het
Med1 A C 11: 98,189,276 L13R possibly damaging Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Myh7 T G 14: 54,975,295 D1431A probably damaging Het
Myo3b G T 2: 70,257,981 G863W probably damaging Het
Nat8f1 G T 6: 85,910,925 Q18K probably benign Het
Ncaph A G 2: 127,108,609 V576A probably benign Het
Nfkbia T G 12: 55,492,411 D39A possibly damaging Het
Nrxn2 G T 19: 6,505,027 G1179C probably damaging Het
Olfr361 A C 2: 37,085,295 V151G probably damaging Het
P4ha1 A G 10: 59,369,633 D495G probably damaging Het
Phf20 C T 2: 156,302,923 A817V probably benign Het
Phlpp2 A T 8: 109,925,799 I592F probably benign Het
Polq A G 16: 37,011,918 S7G unknown Het
Ppfia3 G T 7: 45,348,517 Q729K probably benign Het
Prmt8 A C 6: 127,729,499 F110V probably damaging Het
Psca A T 15: 74,716,019 probably null Het
Pus7 G T 5: 23,775,756 D165E probably benign Het
Raver2 A G 4: 101,137,745 E555G probably damaging Het
Rb1cc1 G A 1: 6,245,171 V457M probably damaging Het
Rbp3 A G 14: 33,954,565 R157G probably benign Het
Rin3 T G 12: 102,369,598 H589Q probably benign Het
Sgk2 T A 2: 163,012,970 S334T probably damaging Het
Sh2d4b T C 14: 40,892,875 M31V probably benign Het
Slc23a3 G A 1: 75,129,627 T316I probably damaging Het
Slc5a4b C A 10: 76,075,091 G304C probably damaging Het
Slc7a14 A G 3: 31,257,610 V87A probably damaging Het
Slitrk3 A T 3: 73,048,831 N869K probably benign Het
St8sia6 T C 2: 13,657,085 R312G possibly damaging Het
Strip2 A T 6: 29,923,969 E94V probably benign Het
Sycp2 T C 2: 178,348,259 D1398G probably damaging Het
Syne1 C A 10: 5,193,040 V114F possibly damaging Het
Syne1 T C 10: 5,330,204 K1630E probably benign Het
Sytl2 A G 7: 90,376,126 N441D probably benign Het
Thsd7a A G 6: 12,501,137 C424R Het
Tln2 T C 9: 67,395,545 D48G probably damaging Het
Treml1 A G 17: 48,366,824 T288A probably damaging Het
Ttn T C 2: 76,765,769 I20267V probably benign Het
Ttn A T 2: 76,848,915 V10821D unknown Het
Vmn2r111 A C 17: 22,548,030 S829A probably benign Het
Xcl1 T A 1: 164,935,510 probably benign Het
Zdhhc23 A T 16: 43,973,864 V149E probably damaging Het
Zfp273 A T 13: 67,822,268 I12F possibly damaging Het
Zfp874a A T 13: 67,442,645 C307S probably damaging Het
Other mutations in Erbb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Erbb3 APN 10 128570983 missense probably damaging 0.99
IGL01482:Erbb3 APN 10 128572929 missense possibly damaging 0.87
IGL01866:Erbb3 APN 10 128569368 makesense probably null
IGL01981:Erbb3 APN 10 128571650 missense probably benign 0.28
IGL02190:Erbb3 APN 10 128571010 splice site probably null
IGL02329:Erbb3 APN 10 128573219 missense probably damaging 1.00
IGL02400:Erbb3 APN 10 128579524 missense probably benign 0.02
IGL02478:Erbb3 APN 10 128571358 nonsense probably null
IGL02502:Erbb3 APN 10 128570284 missense probably benign
IGL02539:Erbb3 APN 10 128584305 splice site probably null
IGL03187:Erbb3 APN 10 128572594 splice site probably benign
I1329:Erbb3 UTSW 10 128583454 missense possibly damaging 0.73
PIT4812001:Erbb3 UTSW 10 128574379 missense possibly damaging 0.67
R0006:Erbb3 UTSW 10 128573410 critical splice donor site probably null
R0006:Erbb3 UTSW 10 128573410 critical splice donor site probably null
R0078:Erbb3 UTSW 10 128583441 missense probably damaging 1.00
R0366:Erbb3 UTSW 10 128572570 missense possibly damaging 0.77
R0601:Erbb3 UTSW 10 128577012 missense probably benign 0.01
R0621:Erbb3 UTSW 10 128586225 missense probably benign 0.00
R1222:Erbb3 UTSW 10 128571665 missense probably damaging 1.00
R1675:Erbb3 UTSW 10 128571204 missense probably damaging 0.97
R1676:Erbb3 UTSW 10 128583248 missense probably benign 0.08
R1692:Erbb3 UTSW 10 128571725 missense probably benign 0.19
R1875:Erbb3 UTSW 10 128574466 missense possibly damaging 0.71
R2002:Erbb3 UTSW 10 128586225 missense probably benign 0.00
R2219:Erbb3 UTSW 10 128569871 missense probably damaging 0.99
R2328:Erbb3 UTSW 10 128583693 missense probably damaging 1.00
R3840:Erbb3 UTSW 10 128570324 missense probably benign
R4393:Erbb3 UTSW 10 128572770 missense probably damaging 1.00
R4567:Erbb3 UTSW 10 128579075 missense probably damaging 1.00
R4616:Erbb3 UTSW 10 128572770 nonsense probably null
R4766:Erbb3 UTSW 10 128586238 missense possibly damaging 0.76
R4881:Erbb3 UTSW 10 128576947 missense probably benign 0.00
R4974:Erbb3 UTSW 10 128572448 missense probably benign
R5266:Erbb3 UTSW 10 128569636 missense probably damaging 1.00
R5463:Erbb3 UTSW 10 128570079 nonsense probably null
R5481:Erbb3 UTSW 10 128572480 missense probably damaging 0.98
R5997:Erbb3 UTSW 10 128583185 missense probably damaging 1.00
R6370:Erbb3 UTSW 10 128570074 missense possibly damaging 0.90
R7639:Erbb3 UTSW 10 128569847 missense probably damaging 0.99
R7713:Erbb3 UTSW 10 128574449 missense probably benign
R7847:Erbb3 UTSW 10 128571189 missense probably damaging 1.00
R8529:Erbb3 UTSW 10 128583200 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAGGAAGCCTTCTGAATGC -3'
(R):5'- AGTGAAAGAAACCTCCCCTGTATG -3'

Sequencing Primer
(F):5'- AAGCCTTCTGAATGCTTCTTCC -3'
(R):5'- AACCTCCCCTGTATGTTTAATTAAC -3'
Posted On2021-07-15