Incidental Mutation 'R8843:Vmn2r111'
ID674569
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Namevomeronasal 2, receptor 111
SynonymsEG210876
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R8843 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location22547941-22573273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 22548030 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 829 (S829A)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
Predicted Effect probably benign
Transcript: ENSMUST00000092491
AA Change: S829A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: S829A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A C 7: 140,249,000 T191P possibly damaging Het
AB124611 C G 9: 21,529,035 Q106E probably benign Het
Abi2 A G 1: 60,453,729 M387V probably null Het
Adra2c A T 5: 35,280,363 N160Y probably damaging Het
Ager G A 17: 34,600,742 R383H probably benign Het
Arhgef28 C T 13: 97,994,049 R427H probably benign Het
Atl1 T A 12: 69,926,148 S81T probably damaging Het
Cdh10 T A 15: 19,013,401 F696I possibly damaging Het
Cdk2ap2 T C 19: 4,097,429 S2P unknown Het
Cela1 G A 15: 100,682,940 T145I probably benign Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Col22a1 A G 15: 72,006,654 I218T probably damaging Het
Copb1 T C 7: 114,221,700 I785V possibly damaging Het
Dnajc16 A T 4: 141,764,691 V607E possibly damaging Het
Dnali1 A T 4: 125,063,621 L110Q probably damaging Het
Epn1 A G 7: 5,093,376 E223G probably benign Het
Erbb3 A G 10: 128,578,456 L473P possibly damaging Het
Fam160a1 A G 3: 85,661,011 I1067T possibly damaging Het
Gadl1 T A 9: 116,006,501 D332E probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Heg1 A G 16: 33,750,493 S1188G probably null Het
Hipk3 G A 2: 104,437,897 A575V probably benign Het
Htt T A 5: 34,889,465 I2375N possibly damaging Het
Klhl24 A T 16: 20,120,230 K512* probably null Het
Krtdap A T 7: 30,789,527 Y40F probably damaging Het
Lhx1 A T 11: 84,519,629 S381T probably benign Het
Lnpep G A 17: 17,552,941 P655L probably damaging Het
Map6d1 A G 16: 20,236,636 V150A probably benign Het
March10 A G 11: 105,401,976 S202P possibly damaging Het
Med1 A C 11: 98,189,276 L13R possibly damaging Het
Mxi1 G A 19: 53,371,695 G283S probably damaging Het
Myh7 T G 14: 54,975,295 D1431A probably damaging Het
Myo3b G T 2: 70,257,981 G863W probably damaging Het
Nat8f1 G T 6: 85,910,925 Q18K probably benign Het
Ncaph A G 2: 127,108,609 V576A probably benign Het
Nfkbia T G 12: 55,492,411 D39A possibly damaging Het
Nrxn2 G T 19: 6,505,027 G1179C probably damaging Het
Olfr361 A C 2: 37,085,295 V151G probably damaging Het
P4ha1 A G 10: 59,369,633 D495G probably damaging Het
Phf20 C T 2: 156,302,923 A817V probably benign Het
Phlpp2 A T 8: 109,925,799 I592F probably benign Het
Polq A G 16: 37,011,918 S7G unknown Het
Ppfia3 G T 7: 45,348,517 Q729K probably benign Het
Prmt8 A C 6: 127,729,499 F110V probably damaging Het
Psca A T 15: 74,716,019 probably null Het
Pus7 G T 5: 23,775,756 D165E probably benign Het
Raver2 A G 4: 101,137,745 E555G probably damaging Het
Rb1cc1 G A 1: 6,245,171 V457M probably damaging Het
Rbp3 A G 14: 33,954,565 R157G probably benign Het
Rin3 T G 12: 102,369,598 H589Q probably benign Het
Sgk2 T A 2: 163,012,970 S334T probably damaging Het
Sh2d4b T C 14: 40,892,875 M31V probably benign Het
Slc23a3 G A 1: 75,129,627 T316I probably damaging Het
Slc5a4b C A 10: 76,075,091 G304C probably damaging Het
Slc7a14 A G 3: 31,257,610 V87A probably damaging Het
Slitrk3 A T 3: 73,048,831 N869K probably benign Het
St8sia6 T C 2: 13,657,085 R312G possibly damaging Het
Strip2 A T 6: 29,923,969 E94V probably benign Het
Sycp2 T C 2: 178,348,259 D1398G probably damaging Het
Syne1 C A 10: 5,193,040 V114F possibly damaging Het
Syne1 T C 10: 5,330,204 K1630E probably benign Het
Sytl2 A G 7: 90,376,126 N441D probably benign Het
Thsd7a A G 6: 12,501,137 C424R Het
Tln2 T C 9: 67,395,545 D48G probably damaging Het
Treml1 A G 17: 48,366,824 T288A probably damaging Het
Ttn T C 2: 76,765,769 I20267V probably benign Het
Ttn A T 2: 76,848,915 V10821D unknown Het
Xcl1 T A 1: 164,935,510 probably benign Het
Zdhhc23 A T 16: 43,973,864 V149E probably damaging Het
Zfp273 A T 13: 67,822,268 I12F possibly damaging Het
Zfp874a A T 13: 67,442,645 C307S probably damaging Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22548753 missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22568984 missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22569016 missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22571985 nonsense probably null
IGL01465:Vmn2r111 APN 17 22548737 missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22548572 missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22571392 missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22569073 splice site probably benign
IGL01962:Vmn2r111 APN 17 22548284 missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22570773 missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22568856 missense probably benign
IGL02519:Vmn2r111 APN 17 22548339 missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22571050 missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22573224 missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22559042 critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22571245 missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22570858 missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22548009 missense probably benign
R0064:Vmn2r111 UTSW 17 22572072 missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22573121 missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22571116 missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22571399 missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22548060 missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22548081 missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22548414 missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22559062 missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22573104 missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22559170 splice site probably benign
R3700:Vmn2r111 UTSW 17 22571161 nonsense probably null
R3782:Vmn2r111 UTSW 17 22571320 missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22559115 missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22573178 missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22548656 missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22548041 missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22571143 missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22571020 missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22548102 nonsense probably null
R5398:Vmn2r111 UTSW 17 22573271 start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22548489 missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22548257 missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22548815 missense probably benign 0.00
R6149:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6207:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22573089 missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22571908 missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22548602 missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7017:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7018:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7024:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7031:Vmn2r111 UTSW 17 22571245 missense probably damaging 1.00
R7039:Vmn2r111 UTSW 17 22548184 missense probably damaging 1.00
R7053:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7054:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7055:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7056:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7145:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7146:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7246:Vmn2r111 UTSW 17 22548714 missense probably damaging 1.00
R7259:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7260:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7327:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7401:Vmn2r111 UTSW 17 22571086 missense possibly damaging 0.93
R7514:Vmn2r111 UTSW 17 22548399 missense probably benign 0.05
R7651:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7781:Vmn2r111 UTSW 17 22570733 missense probably benign 0.17
R7816:Vmn2r111 UTSW 17 22573102 missense probably damaging 0.97
R7821:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7838:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8078:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8080:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8117:Vmn2r111 UTSW 17 22571488 missense probably benign 0.12
R8171:Vmn2r111 UTSW 17 22573092 missense probably benign 0.10
R8195:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8197:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8411:Vmn2r111 UTSW 17 22548581 missense probably benign 0.03
R8539:Vmn2r111 UTSW 17 22571293 missense probably benign 0.23
R8540:Vmn2r111 UTSW 17 22559042 critical splice donor site probably null
R8540:Vmn2r111 UTSW 17 22559043 missense probably damaging 1.00
R8557:Vmn2r111 UTSW 17 22571929 nonsense probably null
R8720:Vmn2r111 UTSW 17 22573213 missense possibly damaging 0.88
R8729:Vmn2r111 UTSW 17 22548258 missense probably damaging 1.00
X0026:Vmn2r111 UTSW 17 22548695 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGCTAGGCAATATCCTTAGAGG -3'
(R):5'- GTCCTTTGGGAGCTTCACTC -3'

Sequencing Primer
(F):5'- CTTAGAGGAAACAGTGAGAGTTATTC -3'
(R):5'- GGGAGCTTCACTCTGGCTTTC -3'
Posted On2021-07-15