Mutagenetix > Incidental Mutation

Incidental Mutation 'R8843:Vmn2r111'

674569

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R8843 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 22548030 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 829 (S829A)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

probably benign
Transcript: ENSMUST00000092491
AA Change: S829A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: S829A

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (73/73)

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830411N06Rik	A	C	7: 140,249,000	T191P	possibly damaging	Het
AB124611	C	G	9: 21,529,035	Q106E	probably benign	Het
Abi2	A	G	1: 60,453,729	M387V	probably null	Het
Adra2c	A	T	5: 35,280,363	N160Y	probably damaging	Het
Ager	G	A	17: 34,600,742	R383H	probably benign	Het
Arhgef28	C	T	13: 97,994,049	R427H	probably benign	Het
Atl1	T	A	12: 69,926,148	S81T	probably damaging	Het
Ccdc80	T	A	16: 45,127,107		probably benign	Het
Cdh10	T	A	15: 19,013,401	F696I	possibly damaging	Het
Cdk2ap2	T	C	19: 4,097,429	S2P	unknown	Het
Cela1	G	A	15: 100,682,940	T145I	probably benign	Het
Celsr2	A	T	3: 108,396,127		probably benign	Het
Cmtm1	TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG	TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG	8: 104,309,702		probably null	Het
Col22a1	A	G	15: 72,006,654	I218T	probably damaging	Het
Copb1	T	C	7: 114,221,700	I785V	possibly damaging	Het
Dnajc16	A	T	4: 141,764,691	V607E	possibly damaging	Het
Dnali1	A	T	4: 125,063,621	L110Q	probably damaging	Het
Epn1	A	G	7: 5,093,376	E223G	probably benign	Het
Erbb3	A	G	10: 128,578,456	L473P	possibly damaging	Het
Fam160a1	A	G	3: 85,661,011	I1067T	possibly damaging	Het
Gadl1	T	A	9: 116,006,501	D332E	probably benign	Het
Gm10801	TC	TCGAC	2: 98,663,806		probably benign	Het
Heg1	A	G	16: 33,750,493	S1188G	probably null	Het
Hipk3	G	A	2: 104,437,897	A575V	probably benign	Het
Htt	T	A	5: 34,889,465	I2375N	possibly damaging	Het
Klhl24	A	T	16: 20,120,230	K512*	probably null	Het
Krtdap	A	T	7: 30,789,527	Y40F	probably damaging	Het
Lhx1	A	T	11: 84,519,629	S381T	probably benign	Het
Lnpep	G	A	17: 17,552,941	P655L	probably damaging	Het
Map6d1	A	G	16: 20,236,636	V150A	probably benign	Het
March10	A	G	11: 105,401,976	S202P	possibly damaging	Het
Med1	A	C	11: 98,189,276	L13R	possibly damaging	Het
Mxi1	G	A	19: 53,371,695	G283S	probably damaging	Het
Myh7	T	G	14: 54,975,295	D1431A	probably damaging	Het
Myo3b	G	T	2: 70,257,981	G863W	probably damaging	Het
Nat8f1	G	T	6: 85,910,925	Q18K	probably benign	Het
Ncaph	A	G	2: 127,108,609	V576A	probably benign	Het
Nfkbia	T	G	12: 55,492,411	D39A	possibly damaging	Het
Nrxn2	G	T	19: 6,505,027	G1179C	probably damaging	Het
Olfr361	A	C	2: 37,085,295	V151G	probably damaging	Het
P4ha1	A	G	10: 59,369,633	D495G	probably damaging	Het
Phf20	C	T	2: 156,302,923	A817V	probably benign	Het
Phlpp2	A	T	8: 109,925,799	I592F	probably benign	Het
Polq	A	G	16: 37,011,918	S7G	unknown	Het
Ppfia3	G	T	7: 45,348,517	Q729K	probably benign	Het
Prmt8	A	C	6: 127,729,499	F110V	probably damaging	Het
Psca	A	T	15: 74,716,019		probably null	Het
Pus7	G	T	5: 23,775,756	D165E	probably benign	Het
Raver2	A	G	4: 101,137,745	E555G	probably damaging	Het
Rb1cc1	G	A	1: 6,245,171	V457M	probably damaging	Het
Rbp3	A	G	14: 33,954,565	R157G	probably benign	Het
Rin3	T	G	12: 102,369,598	H589Q	probably benign	Het
Sgk2	T	A	2: 163,012,970	S334T	probably damaging	Het
Sh2d4b	T	C	14: 40,892,875	M31V	probably benign	Het
Slc23a3	G	A	1: 75,129,627	T316I	probably damaging	Het
Slc5a4b	C	A	10: 76,075,091	G304C	probably damaging	Het
Slc7a14	A	G	3: 31,257,610	V87A	probably damaging	Het
Slitrk3	A	T	3: 73,048,831	N869K	probably benign	Het
St8sia6	T	C	2: 13,657,085	R312G	possibly damaging	Het
Strip2	A	T	6: 29,923,969	E94V	probably benign	Het
Sycp2	T	C	2: 178,348,259	D1398G	probably damaging	Het
Syne1	C	A	10: 5,193,040	V114F	possibly damaging	Het
Syne1	T	C	10: 5,330,204	K1630E	probably benign	Het
Sytl2	A	G	7: 90,376,126	N441D	probably benign	Het
Thsd7a	A	G	6: 12,501,137	C424R		Het
Tln2	T	C	9: 67,395,545	D48G	probably damaging	Het
Treml1	A	G	17: 48,366,824	T288A	probably damaging	Het
Ttn	T	C	2: 76,765,769	I20267V	probably benign	Het
Ttn	A	T	2: 76,848,915	V10821D	unknown	Het
Xcl1	T	A	1: 164,935,510		probably benign	Het
Zdhhc23	A	T	16: 43,973,864	V149E	probably damaging	Het
Zfp273	A	T	13: 67,822,268	I12F	possibly damaging	Het
Zfp874a	A	T	13: 67,442,645	C307S	probably damaging	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R9184:Vmn2r111	UTSW	17	22571841	missense	probably benign
R9374:Vmn2r111	UTSW	17	22568878	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22559151	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TTGCTAGGCAATATCCTTAGAGG -3'
(R):5'- GTCCTTTGGGAGCTTCACTC -3'

Sequencing Primer
(F):5'- CTTAGAGGAAACAGTGAGAGTTATTC -3'
(R):5'- GGGAGCTTCACTCTGGCTTTC -3'

Posted On

2021-07-15