Incidental Mutation 'R8844:Galnt3'
ID 674576
Institutional Source Beutler Lab
Gene Symbol Galnt3
Ensembl Gene ENSMUSG00000026994
Gene Name polypeptide N-acetylgalactosaminyltransferase 3
Synonyms ppGaNTase-T3
MMRRC Submission 068733-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.380) question?
Stock # R8844 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 65913110-65955217 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65915636 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 575 (V575A)
Ref Sequence ENSEMBL: ENSMUSP00000028378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028378]
AlphaFold P70419
Predicted Effect probably benign
Transcript: ENSMUST00000028378
AA Change: V575A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028378
Gene: ENSMUSG00000026994
AA Change: V575A

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 185 440 8.3e-10 PFAM
Pfam:Glycos_transf_2 188 374 1.2e-35 PFAM
Pfam:Glyco_transf_7C 345 423 7.7e-14 PFAM
RICIN 506 630 2.71e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes UDP-GalNAc transferase 3, a member of the GalNAc-transferases family. This family transfers an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. Individual GalNAc-transferases have distinct activities and initiation of O-glycosylation is regulated by a repertoire of GalNAc-transferases. The protein encoded by this gene is highly homologous to other family members, however the enzymes have different substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating alkaline phosphatase, hypercalcemia, hyperphosphatemia, decreased circulating parathyroid hormone, and male specific postnatal growth retardation, infertility, and increase in bone density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,595,011 (GRCm39) H89L possibly damaging Het
Ahnak T C 19: 8,984,254 (GRCm39) V1846A probably damaging Het
Arhgap9 A T 10: 127,161,015 (GRCm39) T181S probably benign Het
Bmp10 A G 6: 87,410,681 (GRCm39) Y158C probably damaging Het
Clec14a A G 12: 58,315,599 (GRCm39) C8R possibly damaging Het
Cntln A G 4: 84,892,234 (GRCm39) H373R probably damaging Het
Cpn2 A G 16: 30,078,115 (GRCm39) S529P probably damaging Het
Csmd3 T C 15: 47,604,590 (GRCm39) N1051S probably damaging Het
Csmd3 G A 15: 48,536,815 (GRCm39) T129M probably damaging Het
F12 T C 13: 55,568,198 (GRCm39) H432R probably damaging Het
Foxm1 T C 6: 128,350,439 (GRCm39) F595S probably damaging Het
Foxred2 A T 15: 77,832,677 (GRCm39) I410N probably benign Het
Fstl5 T A 3: 76,337,154 (GRCm39) F238I possibly damaging Het
Gpr149 T A 3: 62,502,572 (GRCm39) Y428F probably benign Het
Gtf2ird1 A T 5: 134,389,879 (GRCm39) Y970* probably null Het
Hint2 G C 4: 43,654,343 (GRCm39) Q157E probably damaging Het
Ighe T C 12: 113,235,006 (GRCm39) T385A Het
Kcnc4 G A 3: 107,355,396 (GRCm39) R351C probably damaging Het
Kif7 A G 7: 79,357,280 (GRCm39) L642S possibly damaging Het
Lilra5 T A 7: 4,241,663 (GRCm39) V154D probably damaging Het
Morc2b A G 17: 33,354,742 (GRCm39) L1010P probably damaging Het
Mphosph10 C A 7: 64,027,087 (GRCm39) K575N probably damaging Het
Mup7 C A 4: 60,067,537 (GRCm39) E193* probably null Het
Nbea T C 3: 55,998,415 (GRCm39) T131A probably damaging Het
Nostrin T C 2: 69,006,060 (GRCm39) I248T probably damaging Het
Nrxn3 A T 12: 89,153,920 (GRCm39) I296F possibly damaging Het
Odam A G 5: 88,037,322 (GRCm39) E172G probably damaging Het
Optn A G 2: 5,031,923 (GRCm39) probably null Het
Or5ac16 G C 16: 59,021,929 (GRCm39) P287A probably damaging Het
Osbpl8 T A 10: 111,112,336 (GRCm39) Y484N probably damaging Het
Patj A G 4: 98,480,206 (GRCm39) N1308D probably damaging Het
Pcdhb17 A T 18: 37,618,801 (GRCm39) E197V probably benign Het
Pcolce2 G A 9: 95,563,625 (GRCm39) D204N possibly damaging Het
Plxna4 T G 6: 32,174,026 (GRCm39) T1190P probably benign Het
Pramel22 A T 4: 143,380,976 (GRCm39) F349Y probably damaging Het
Pzp T C 6: 128,500,950 (GRCm39) Y136C probably damaging Het
Scn10a A T 9: 119,446,791 (GRCm39) N1411K probably damaging Het
Scube1 A G 15: 83,561,164 (GRCm39) C143R probably damaging Het
Stau1 T C 2: 166,793,266 (GRCm39) T290A probably benign Het
Sycp1 T A 3: 102,772,421 (GRCm39) K629I probably damaging Het
Taf1d A G 9: 15,221,324 (GRCm39) E210G probably damaging Het
Tecpr1 T C 5: 144,153,117 (GRCm39) E204G possibly damaging Het
Tmem229a T C 6: 24,955,187 (GRCm39) D189G probably benign Het
Tmem269 G A 4: 119,062,876 (GRCm39) P254S probably damaging Het
Top1 T A 2: 160,563,469 (GRCm39) F767I probably damaging Het
Ube2q2 C A 9: 55,102,757 (GRCm39) A331D Het
Usp1 A G 4: 98,823,017 (GRCm39) Y777C probably damaging Het
Usp29 A G 7: 6,964,891 (GRCm39) N245D probably benign Het
Vmn1r212 T A 13: 23,067,526 (GRCm39) Q269L probably benign Het
Wfdc11 T A 2: 164,507,373 (GRCm39) Y28F probably benign Het
Wwp2 A T 8: 108,210,048 (GRCm39) D142V probably damaging Het
Other mutations in Galnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Galnt3 APN 2 65,925,628 (GRCm39) missense probably damaging 1.00
IGL01563:Galnt3 APN 2 65,928,101 (GRCm39) missense probably damaging 0.97
IGL01973:Galnt3 APN 2 65,914,606 (GRCm39) missense probably benign 0.03
IGL02004:Galnt3 APN 2 65,926,270 (GRCm39) missense probably damaging 1.00
IGL02424:Galnt3 APN 2 65,926,132 (GRCm39) critical splice donor site probably null
IGL02946:Galnt3 APN 2 65,925,562 (GRCm39) missense probably damaging 0.99
IGL03059:Galnt3 APN 2 65,923,954 (GRCm39) missense probably damaging 1.00
PIT4531001:Galnt3 UTSW 2 65,937,432 (GRCm39) missense probably benign 0.03
R0437:Galnt3 UTSW 2 65,937,573 (GRCm39) missense possibly damaging 0.74
R1390:Galnt3 UTSW 2 65,921,567 (GRCm39) missense probably damaging 1.00
R1536:Galnt3 UTSW 2 65,914,550 (GRCm39) missense probably damaging 1.00
R1869:Galnt3 UTSW 2 65,928,123 (GRCm39) missense possibly damaging 0.82
R2987:Galnt3 UTSW 2 65,914,585 (GRCm39) missense probably benign 0.00
R3973:Galnt3 UTSW 2 65,937,374 (GRCm39) missense possibly damaging 0.77
R4039:Galnt3 UTSW 2 65,915,671 (GRCm39) missense probably damaging 0.96
R4515:Galnt3 UTSW 2 65,923,954 (GRCm39) missense probably damaging 1.00
R4518:Galnt3 UTSW 2 65,923,954 (GRCm39) missense probably damaging 1.00
R4519:Galnt3 UTSW 2 65,923,954 (GRCm39) missense probably damaging 1.00
R4577:Galnt3 UTSW 2 65,928,203 (GRCm39) missense probably benign 0.02
R4817:Galnt3 UTSW 2 65,923,883 (GRCm39) missense possibly damaging 0.83
R5008:Galnt3 UTSW 2 65,915,585 (GRCm39) missense probably benign 0.04
R5191:Galnt3 UTSW 2 65,924,050 (GRCm39) missense probably damaging 1.00
R5947:Galnt3 UTSW 2 65,914,500 (GRCm39) utr 3 prime probably benign
R6534:Galnt3 UTSW 2 65,932,875 (GRCm39) missense probably damaging 1.00
R7196:Galnt3 UTSW 2 65,921,268 (GRCm39) missense probably damaging 1.00
R7817:Galnt3 UTSW 2 65,926,243 (GRCm39) missense probably damaging 1.00
R7951:Galnt3 UTSW 2 65,928,186 (GRCm39) missense probably benign 0.00
R7952:Galnt3 UTSW 2 65,928,186 (GRCm39) missense probably benign 0.00
R8071:Galnt3 UTSW 2 65,921,555 (GRCm39) missense probably benign 0.28
R8513:Galnt3 UTSW 2 65,924,064 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTTCACCTACAGAAGCCAAGC -3'
(R):5'- TCCACAGAGCCTGTCGTAAC -3'

Sequencing Primer
(F):5'- GCCAAGCGTAACTTTATCACTAG -3'
(R):5'- GAGCCTGTCGTAACTAATGCC -3'
Posted On 2021-07-15