Incidental Mutation 'R8844:Sycp1'
ID 674584
Institutional Source Beutler Lab
Gene Symbol Sycp1
Ensembl Gene ENSMUSG00000027855
Gene Name synaptonemal complex protein 1
Synonyms SCP1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.464) question?
Stock # R8844 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 102818499-102936100 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 102865105 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Isoleucine at position 629 (K629I)
Ref Sequence ENSEMBL: ENSMUSP00000029448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029448] [ENSMUST00000196988]
AlphaFold Q62209
Predicted Effect probably damaging
Transcript: ENSMUST00000029448
AA Change: K629I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029448
Gene: ENSMUSG00000027855
AA Change: K629I

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196988
AA Change: K629I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143651
Gene: ENSMUSG00000027855
AA Change: K629I

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display male and female infertility, azoospermia, small ovary, small testis and seminiferous tubules, absent ovarian follicles, and failure of synapse formation during meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,218 H89L possibly damaging Het
Ahnak T C 19: 9,006,890 V1846A probably damaging Het
Arhgap9 A T 10: 127,325,146 T181S probably benign Het
Bmp10 A G 6: 87,433,699 Y158C probably damaging Het
Clec14a A G 12: 58,268,813 C8R possibly damaging Het
Cntln A G 4: 84,973,997 H373R probably damaging Het
Cpn2 A G 16: 30,259,297 S529P probably damaging Het
Csmd3 T C 15: 47,741,194 N1051S probably damaging Het
Csmd3 G A 15: 48,673,419 T129M probably damaging Het
F12 T C 13: 55,420,385 H432R probably damaging Het
Foxm1 T C 6: 128,373,476 F595S probably damaging Het
Foxred2 A T 15: 77,948,477 I410N probably benign Het
Fstl5 T A 3: 76,429,847 F238I possibly damaging Het
Galnt3 A G 2: 66,085,292 V575A probably benign Het
Gm13088 A T 4: 143,654,406 F349Y probably damaging Het
Gpr149 T A 3: 62,595,151 Y428F probably benign Het
Gtf2ird1 A T 5: 134,361,025 Y970* probably null Het
Hint2 G C 4: 43,654,343 Q157E probably damaging Het
Ighe T C 12: 113,271,386 T385A Het
Kcnc4 G A 3: 107,448,080 R351C probably damaging Het
Kif7 A G 7: 79,707,532 L642S possibly damaging Het
Lilra5 T A 7: 4,238,664 V154D probably damaging Het
Morc2b A G 17: 33,135,768 L1010P probably damaging Het
Mphosph10 C A 7: 64,377,339 K575N probably damaging Het
Mup7 C A 4: 60,067,537 E193* probably null Het
Nbea T C 3: 56,090,994 T131A probably damaging Het
Nostrin T C 2: 69,175,716 I248T probably damaging Het
Nrxn3 A T 12: 89,187,150 I296F possibly damaging Het
Odam A G 5: 87,889,463 E172G probably damaging Het
Olfr198 G C 16: 59,201,566 P287A probably damaging Het
Optn A G 2: 5,027,112 probably null Het
Osbpl8 T A 10: 111,276,475 Y484N probably damaging Het
Patj A G 4: 98,591,969 N1308D probably damaging Het
Pcdhb17 A T 18: 37,485,748 E197V probably benign Het
Pcolce2 G A 9: 95,681,572 D204N possibly damaging Het
Plxna4 T G 6: 32,197,091 T1190P probably benign Het
Pzp T C 6: 128,523,987 Y136C probably damaging Het
Scn10a A T 9: 119,617,725 N1411K probably damaging Het
Scube1 A G 15: 83,676,963 C143R probably damaging Het
Stau1 T C 2: 166,951,346 T290A probably benign Het
Taf1d A G 9: 15,310,028 E210G probably damaging Het
Tecpr1 T C 5: 144,216,299 E204G possibly damaging Het
Tmem229a T C 6: 24,955,188 D189G probably benign Het
Tmem269 G A 4: 119,205,679 P254S probably damaging Het
Top1 T A 2: 160,721,549 F767I probably damaging Het
Ube2q2 C A 9: 55,195,473 A331D Het
Usp1 A G 4: 98,934,780 Y777C probably damaging Het
Usp29 A G 7: 6,961,892 N245D probably benign Het
Vmn1r212 T A 13: 22,883,356 Q269L probably benign Het
Wfdc11 T A 2: 164,665,453 Y28F probably benign Het
Wwp2 A T 8: 107,483,416 D142V probably damaging Het
Other mutations in Sycp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Sycp1 APN 3 102840962 missense probably benign
IGL00833:Sycp1 APN 3 102876301 critical splice donor site probably null
IGL01066:Sycp1 APN 3 102920634 missense probably damaging 1.00
IGL01484:Sycp1 APN 3 102915867 missense probably benign 0.01
IGL02139:Sycp1 APN 3 102865114 missense probably benign 0.00
IGL02270:Sycp1 APN 3 102895943 missense probably benign 0.12
IGL02347:Sycp1 APN 3 102893547 missense probably benign 0.00
IGL02630:Sycp1 APN 3 102878764 splice site probably benign
IGL02668:Sycp1 APN 3 102820531 splice site probably benign
IGL02928:Sycp1 APN 3 102818818 utr 3 prime probably benign
PIT4458001:Sycp1 UTSW 3 102934833 missense probably benign 0.01
R0027:Sycp1 UTSW 3 102895910 missense probably benign
R0282:Sycp1 UTSW 3 102915795 splice site probably benign
R0462:Sycp1 UTSW 3 102819106 missense possibly damaging 0.75
R0609:Sycp1 UTSW 3 102898849 splice site probably null
R0837:Sycp1 UTSW 3 102915245 missense probably benign 0.17
R1301:Sycp1 UTSW 3 102920622 missense probably benign 0.02
R2408:Sycp1 UTSW 3 102925259 missense probably damaging 1.00
R2449:Sycp1 UTSW 3 102925206 missense probably benign 0.15
R2516:Sycp1 UTSW 3 102845066 missense probably benign 0.09
R2880:Sycp1 UTSW 3 102818898 missense probably damaging 0.99
R3410:Sycp1 UTSW 3 102841041 missense possibly damaging 0.94
R3427:Sycp1 UTSW 3 102876350 missense probably benign 0.00
R4538:Sycp1 UTSW 3 102840962 missense probably benign
R4679:Sycp1 UTSW 3 102922462 critical splice acceptor site probably null
R4707:Sycp1 UTSW 3 102853489 missense possibly damaging 0.92
R4785:Sycp1 UTSW 3 102853489 missense possibly damaging 0.92
R5017:Sycp1 UTSW 3 102895987 splice site probably null
R5036:Sycp1 UTSW 3 102820600 missense probably damaging 1.00
R5044:Sycp1 UTSW 3 102845054 missense probably benign 0.03
R5070:Sycp1 UTSW 3 102920565 missense probably damaging 0.97
R5079:Sycp1 UTSW 3 102878800 missense possibly damaging 0.67
R5289:Sycp1 UTSW 3 102934253 missense possibly damaging 0.85
R5393:Sycp1 UTSW 3 102841047 splice site probably null
R5477:Sycp1 UTSW 3 102818890 missense probably damaging 1.00
R5576:Sycp1 UTSW 3 102818902 missense probably damaging 0.98
R5814:Sycp1 UTSW 3 102895897 missense probably benign 0.03
R6291:Sycp1 UTSW 3 102908961 missense probably damaging 1.00
R6460:Sycp1 UTSW 3 102925253 missense probably damaging 1.00
R6527:Sycp1 UTSW 3 102898887 missense probably benign 0.09
R6870:Sycp1 UTSW 3 102935603 missense probably damaging 1.00
R6873:Sycp1 UTSW 3 102840980 missense probably benign
R7037:Sycp1 UTSW 3 102898934 missense possibly damaging 0.62
R7210:Sycp1 UTSW 3 102853492 missense probably damaging 1.00
R7405:Sycp1 UTSW 3 102925227 missense possibly damaging 0.72
R7604:Sycp1 UTSW 3 102913433 missense probably damaging 0.98
R7733:Sycp1 UTSW 3 102895962 missense probably benign 0.00
R7858:Sycp1 UTSW 3 102898957 missense probably benign 0.09
R7909:Sycp1 UTSW 3 102820626 nonsense probably null
R8109:Sycp1 UTSW 3 102851602 missense probably benign 0.21
R8141:Sycp1 UTSW 3 102935569 missense possibly damaging 0.73
R8289:Sycp1 UTSW 3 102841037 missense probably benign 0.01
R8359:Sycp1 UTSW 3 102820593 missense probably damaging 0.98
R9020:Sycp1 UTSW 3 102876337 missense probably benign 0.01
R9149:Sycp1 UTSW 3 102851628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTGTTTGATTTCTGCTGAACTC -3'
(R):5'- AGCTTGACCAAGAGGCATATTTTG -3'

Sequencing Primer
(F):5'- TGCCAATGGCTTACACT -3'
(R):5'- GCATATTTTGCCTGTAAGTTTA -3'
Posted On 2021-07-15