Incidental Mutation 'R8844:Tecpr1'
ID674596
Institutional Source Beutler Lab
Gene Symbol Tecpr1
Ensembl Gene ENSMUSG00000066621
Gene Nametectonin beta-propeller repeat containing 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8844 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location144194442-144223615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144216299 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 204 (E204G)
Ref Sequence ENSEMBL: ENSMUSP00000082844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085701]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085701
AA Change: E204G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: E204G

DomainStartEndE-ValueType
TECPR 23 59 8.98e1 SMART
DysFN 64 125 6.72e-24 SMART
DysFC 137 170 1.89e-9 SMART
TECPR 192 225 1.79e-1 SMART
TECPR 234 270 2.5e-9 SMART
TECPR 279 317 4.99e-9 SMART
TECPR 326 361 2.42e-7 SMART
low complexity region 381 394 N/A INTRINSIC
PH 614 724 1.69e-2 SMART
TECPR 711 750 1.88e-4 SMART
TECPR 766 800 3.27e-4 SMART
DysFN 821 882 2.95e-20 SMART
DysFC 893 926 1.66e-14 SMART
TECPR 940 974 1.69e1 SMART
TECPR 983 1019 1.45e-5 SMART
TECPR 1028 1065 1.51e-8 SMART
TECPR 1074 1109 1.59e-2 SMART
low complexity region 1125 1137 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,218 H89L possibly damaging Het
Ahnak T C 19: 9,006,890 V1846A probably damaging Het
Arhgap9 A T 10: 127,325,146 T181S probably benign Het
Bmp10 A G 6: 87,433,699 Y158C probably damaging Het
Clec14a A G 12: 58,268,813 C8R possibly damaging Het
Cntln A G 4: 84,973,997 H373R probably damaging Het
Cpn2 A G 16: 30,259,297 S529P probably damaging Het
Csmd3 T C 15: 47,741,194 N1051S probably damaging Het
Csmd3 G A 15: 48,673,419 T129M probably damaging Het
F12 T C 13: 55,420,385 H432R probably damaging Het
Foxm1 T C 6: 128,373,476 F595S probably damaging Het
Foxred2 A T 15: 77,948,477 I410N probably benign Het
Fstl5 T A 3: 76,429,847 F238I possibly damaging Het
Galnt3 A G 2: 66,085,292 V575A probably benign Het
Gm13088 A T 4: 143,654,406 F349Y probably damaging Het
Gpr149 T A 3: 62,595,151 Y428F probably benign Het
Gtf2ird1 A T 5: 134,361,025 Y970* probably null Het
Hint2 G C 4: 43,654,343 Q157E probably damaging Het
Ighe T C 12: 113,271,386 T385A Het
Kcnc4 G A 3: 107,448,080 R351C probably damaging Het
Kif7 A G 7: 79,707,532 L642S possibly damaging Het
Lilra5 T A 7: 4,238,664 V154D probably damaging Het
Morc2b A G 17: 33,135,768 L1010P probably damaging Het
Mphosph10 C A 7: 64,377,339 K575N probably damaging Het
Mup7 C A 4: 60,067,537 E193* probably null Het
Nbea T C 3: 56,090,994 T131A probably damaging Het
Nostrin T C 2: 69,175,716 I248T probably damaging Het
Nrxn3 A T 12: 89,187,150 I296F possibly damaging Het
Odam A G 5: 87,889,463 E172G probably damaging Het
Olfr198 G C 16: 59,201,566 P287A probably damaging Het
Optn A G 2: 5,027,112 probably null Het
Osbpl8 T A 10: 111,276,475 Y484N probably damaging Het
Patj A G 4: 98,591,969 N1308D probably damaging Het
Pcdhb17 A T 18: 37,485,748 E197V probably benign Het
Pcolce2 G A 9: 95,681,572 D204N possibly damaging Het
Plxna4 T G 6: 32,197,091 T1190P probably benign Het
Pzp T C 6: 128,523,987 Y136C probably damaging Het
Scn10a A T 9: 119,617,725 N1411K probably damaging Het
Scube1 A G 15: 83,676,963 C143R probably damaging Het
Stau1 T C 2: 166,951,346 T290A probably benign Het
Sycp1 T A 3: 102,865,105 K629I probably damaging Het
Taf1d A G 9: 15,310,028 E210G probably damaging Het
Tmem229a T C 6: 24,955,188 D189G probably benign Het
Tmem269 G A 4: 119,205,679 P254S probably damaging Het
Top1 T A 2: 160,721,549 F767I probably damaging Het
Ube2q2 C A 9: 55,195,473 A331D Het
Usp1 A G 4: 98,934,780 Y777C probably damaging Het
Usp29 A G 7: 6,961,892 N245D probably benign Het
Vmn1r212 T A 13: 22,883,356 Q269L probably benign Het
Wfdc11 T A 2: 164,665,453 Y28F probably benign Het
Wwp2 A T 8: 107,483,416 D142V probably damaging Het
Other mutations in Tecpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Tecpr1 APN 5 144208593 critical splice donor site probably null
IGL01774:Tecpr1 APN 5 144211540 missense probably damaging 0.97
IGL01960:Tecpr1 APN 5 144216919 missense probably benign 0.00
IGL01973:Tecpr1 APN 5 144197988 splice site probably benign
IGL02244:Tecpr1 APN 5 144210003 missense probably benign
IGL02247:Tecpr1 APN 5 144206554 missense possibly damaging 0.64
IGL02423:Tecpr1 APN 5 144203487 missense possibly damaging 0.88
IGL02679:Tecpr1 APN 5 144206546 missense probably benign 0.28
larghissimo UTSW 5 144217257 missense probably damaging 1.00
PIT4531001:Tecpr1 UTSW 5 144214067 missense probably damaging 0.96
R0121:Tecpr1 UTSW 5 144210199 missense probably benign 0.02
R0125:Tecpr1 UTSW 5 144197899 missense probably damaging 1.00
R0194:Tecpr1 UTSW 5 144218517 missense probably damaging 1.00
R0376:Tecpr1 UTSW 5 144207476 missense possibly damaging 0.94
R0441:Tecpr1 UTSW 5 144195941 missense probably benign
R0504:Tecpr1 UTSW 5 144214081 missense probably damaging 0.99
R0538:Tecpr1 UTSW 5 144206274 missense probably damaging 0.99
R0586:Tecpr1 UTSW 5 144217401 missense probably damaging 1.00
R0607:Tecpr1 UTSW 5 144212590 missense probably damaging 1.00
R0608:Tecpr1 UTSW 5 144211499 missense probably damaging 1.00
R0656:Tecpr1 UTSW 5 144214053 splice site probably null
R0835:Tecpr1 UTSW 5 144212592 missense possibly damaging 0.81
R1080:Tecpr1 UTSW 5 144216929 missense probably damaging 1.00
R1394:Tecpr1 UTSW 5 144206539 missense possibly damaging 0.77
R1597:Tecpr1 UTSW 5 144214310 missense probably benign 0.00
R1663:Tecpr1 UTSW 5 144197944 missense probably benign 0.17
R1785:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1786:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1833:Tecpr1 UTSW 5 144208608 missense probably damaging 0.99
R1883:Tecpr1 UTSW 5 144206529 missense probably benign 0.03
R1988:Tecpr1 UTSW 5 144204697 missense possibly damaging 0.94
R2130:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2131:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2132:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2133:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2172:Tecpr1 UTSW 5 144196417 missense probably damaging 1.00
R2172:Tecpr1 UTSW 5 144211456 missense probably benign 0.10
R2290:Tecpr1 UTSW 5 144214063 missense probably damaging 0.99
R3691:Tecpr1 UTSW 5 144209979 missense probably benign 0.10
R4027:Tecpr1 UTSW 5 144206259 missense probably benign 0.41
R4587:Tecpr1 UTSW 5 144212590 missense probably damaging 0.96
R4684:Tecpr1 UTSW 5 144207437 missense probably benign 0.16
R4864:Tecpr1 UTSW 5 144214117 missense probably benign 0.00
R4932:Tecpr1 UTSW 5 144204658 missense probably damaging 0.97
R4955:Tecpr1 UTSW 5 144217257 missense probably damaging 1.00
R5043:Tecpr1 UTSW 5 144197854 splice site probably null
R5459:Tecpr1 UTSW 5 144207416 missense probably damaging 1.00
R5579:Tecpr1 UTSW 5 144214344 missense possibly damaging 0.55
R5677:Tecpr1 UTSW 5 144218633 nonsense probably null
R5679:Tecpr1 UTSW 5 144207423 missense possibly damaging 0.69
R5802:Tecpr1 UTSW 5 144206546 missense probably benign 0.28
R6000:Tecpr1 UTSW 5 144211421 missense probably benign 0.02
R6022:Tecpr1 UTSW 5 144199191 missense possibly damaging 0.95
R6114:Tecpr1 UTSW 5 144204640 missense possibly damaging 0.81
R6251:Tecpr1 UTSW 5 144198576 missense probably damaging 0.97
R6372:Tecpr1 UTSW 5 144216958 missense probably damaging 1.00
R6493:Tecpr1 UTSW 5 144209974 missense probably benign
R7276:Tecpr1 UTSW 5 144217020 nonsense probably null
R7314:Tecpr1 UTSW 5 144217332 missense probably damaging 1.00
R7375:Tecpr1 UTSW 5 144208599 missense possibly damaging 0.68
R7632:Tecpr1 UTSW 5 144218726 missense probably benign 0.03
R7702:Tecpr1 UTSW 5 144203418 missense probably damaging 1.00
R8135:Tecpr1 UTSW 5 144198602 missense probably damaging 0.99
R8406:Tecpr1 UTSW 5 144200840 missense probably damaging 1.00
R8856:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8857:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8866:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8926:Tecpr1 UTSW 5 144216962 missense probably damaging 1.00
RF001:Tecpr1 UTSW 5 144217386 missense probably damaging 0.99
Z1176:Tecpr1 UTSW 5 144218591 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ACCATACAAAATCTTGGGCAAG -3'
(R):5'- TCTTGAAGCCAGACAGCGTG -3'

Sequencing Primer
(F):5'- CTTGGGCAAGATGGTGGTG -3'
(R):5'- AGACAGCGTGGGCCTTG -3'
Posted On2021-07-15