Incidental Mutation 'R8844:Bmp10'
ID 674599
Institutional Source Beutler Lab
Gene Symbol Bmp10
Ensembl Gene ENSMUSG00000030046
Gene Name bone morphogenetic protein 10
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8844 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 87428994-87437677 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87433699 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 158 (Y158C)
Ref Sequence ENSEMBL: ENSMUSP00000032125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032125]
AlphaFold Q9R229
Predicted Effect probably damaging
Transcript: ENSMUST00000032125
AA Change: Y158C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032125
Gene: ENSMUSG00000030046
AA Change: Y158C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TGFb_propeptide 52 256 8.1e-24 PFAM
TGFB 320 420 6.7e-52 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which binds to the activin receptor-like kinase 1 (ALK1) and plays important roles in cardiovascular development including cardiomyocyte proliferation and regulation of heart size, closure of the ductus arteriosus, angiogenesis and ventricular trabeculation. Homozygous knockout mice for this gene exhibit impaired heart development and embryonic lethality. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice display decreased embryo size, cardiac dysgenesis, defects in early embryonic vascular development, enlarged pericardium, arteriovenous malformations, and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,218 H89L possibly damaging Het
Ahnak T C 19: 9,006,890 V1846A probably damaging Het
Arhgap9 A T 10: 127,325,146 T181S probably benign Het
Clec14a A G 12: 58,268,813 C8R possibly damaging Het
Cntln A G 4: 84,973,997 H373R probably damaging Het
Cpn2 A G 16: 30,259,297 S529P probably damaging Het
Csmd3 T C 15: 47,741,194 N1051S probably damaging Het
Csmd3 G A 15: 48,673,419 T129M probably damaging Het
F12 T C 13: 55,420,385 H432R probably damaging Het
Foxm1 T C 6: 128,373,476 F595S probably damaging Het
Foxred2 A T 15: 77,948,477 I410N probably benign Het
Fstl5 T A 3: 76,429,847 F238I possibly damaging Het
Galnt3 A G 2: 66,085,292 V575A probably benign Het
Gm13088 A T 4: 143,654,406 F349Y probably damaging Het
Gpr149 T A 3: 62,595,151 Y428F probably benign Het
Gtf2ird1 A T 5: 134,361,025 Y970* probably null Het
Hint2 G C 4: 43,654,343 Q157E probably damaging Het
Ighe T C 12: 113,271,386 T385A Het
Kcnc4 G A 3: 107,448,080 R351C probably damaging Het
Kif7 A G 7: 79,707,532 L642S possibly damaging Het
Lilra5 T A 7: 4,238,664 V154D probably damaging Het
Morc2b A G 17: 33,135,768 L1010P probably damaging Het
Mphosph10 C A 7: 64,377,339 K575N probably damaging Het
Mup7 C A 4: 60,067,537 E193* probably null Het
Nbea T C 3: 56,090,994 T131A probably damaging Het
Nostrin T C 2: 69,175,716 I248T probably damaging Het
Nrxn3 A T 12: 89,187,150 I296F possibly damaging Het
Odam A G 5: 87,889,463 E172G probably damaging Het
Olfr198 G C 16: 59,201,566 P287A probably damaging Het
Optn A G 2: 5,027,112 probably null Het
Osbpl8 T A 10: 111,276,475 Y484N probably damaging Het
Patj A G 4: 98,591,969 N1308D probably damaging Het
Pcdhb17 A T 18: 37,485,748 E197V probably benign Het
Pcolce2 G A 9: 95,681,572 D204N possibly damaging Het
Plxna4 T G 6: 32,197,091 T1190P probably benign Het
Pzp T C 6: 128,523,987 Y136C probably damaging Het
Scn10a A T 9: 119,617,725 N1411K probably damaging Het
Scube1 A G 15: 83,676,963 C143R probably damaging Het
Stau1 T C 2: 166,951,346 T290A probably benign Het
Sycp1 T A 3: 102,865,105 K629I probably damaging Het
Taf1d A G 9: 15,310,028 E210G probably damaging Het
Tecpr1 T C 5: 144,216,299 E204G possibly damaging Het
Tmem229a T C 6: 24,955,188 D189G probably benign Het
Tmem269 G A 4: 119,205,679 P254S probably damaging Het
Top1 T A 2: 160,721,549 F767I probably damaging Het
Ube2q2 C A 9: 55,195,473 A331D Het
Usp1 A G 4: 98,934,780 Y777C probably damaging Het
Usp29 A G 7: 6,961,892 N245D probably benign Het
Vmn1r212 T A 13: 22,883,356 Q269L probably benign Het
Wfdc11 T A 2: 164,665,453 Y28F probably benign Het
Wwp2 A T 8: 107,483,416 D142V probably damaging Het
Other mutations in Bmp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Bmp10 APN 6 87429160 missense possibly damaging 0.87
IGL00946:Bmp10 APN 6 87434362 missense probably damaging 1.00
IGL01483:Bmp10 APN 6 87433951 missense probably damaging 1.00
IGL02132:Bmp10 APN 6 87434148 missense probably benign
R1391:Bmp10 UTSW 6 87433758 missense probably benign 0.00
R1472:Bmp10 UTSW 6 87433797 missense probably benign 0.34
R1938:Bmp10 UTSW 6 87433720 missense possibly damaging 0.77
R2114:Bmp10 UTSW 6 87434459 missense probably benign 0.10
R2158:Bmp10 UTSW 6 87434080 missense probably benign 0.21
R4922:Bmp10 UTSW 6 87433575 missense probably benign 0.00
R5042:Bmp10 UTSW 6 87434057 missense probably damaging 0.98
R6041:Bmp10 UTSW 6 87434320 missense probably damaging 1.00
R7000:Bmp10 UTSW 6 87434193 missense probably benign 0.02
R7593:Bmp10 UTSW 6 87433669 missense probably damaging 1.00
R8682:Bmp10 UTSW 6 87433559 critical splice acceptor site probably null
R9378:Bmp10 UTSW 6 87433702 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GCATACTGCAAGTCTGGTTTCTC -3'
(R):5'- TGGGCACTCATATCTATTTCCAG -3'

Sequencing Primer
(F):5'- CTGCAAGTCTGGTTTCTCATAAG -3'
(R):5'- TCCGGTGTCCTCAGCTTGG -3'
Posted On 2021-07-15