Incidental Mutation 'R8844:Cpn2'
ID 674622
Institutional Source Beutler Lab
Gene Symbol Cpn2
Ensembl Gene ENSMUSG00000023176
Gene Name carboxypeptidase N, polypeptide 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R8844 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 30256378-30267499 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30259297 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 529 (S529P)
Ref Sequence ENSEMBL: ENSMUSP00000069318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064856]
AlphaFold Q9DBB9
Predicted Effect probably damaging
Transcript: ENSMUST00000064856
AA Change: S529P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069318
Gene: ENSMUSG00000023176
AA Change: S529P

DomainStartEndE-ValueType
LRRNT 21 53 3.21e-8 SMART
LRR 96 119 1.22e2 SMART
LRR 120 143 5.11e0 SMART
LRR_TYP 144 167 2.71e-2 SMART
LRR_TYP 168 191 3.21e-4 SMART
LRR_TYP 192 215 5.9e-3 SMART
LRR_TYP 216 239 6.88e-4 SMART
LRR 240 263 6.57e-1 SMART
LRR_TYP 264 287 2.12e-4 SMART
LRR 289 311 3.07e-1 SMART
LRR_TYP 312 335 2.61e-4 SMART
LRR_TYP 336 359 5.9e-3 SMART
LRR_TYP 360 383 2.79e-4 SMART
LRRCT 395 446 7.34e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,218 H89L possibly damaging Het
Ahnak T C 19: 9,006,890 V1846A probably damaging Het
Arhgap9 A T 10: 127,325,146 T181S probably benign Het
Bmp10 A G 6: 87,433,699 Y158C probably damaging Het
Clec14a A G 12: 58,268,813 C8R possibly damaging Het
Cntln A G 4: 84,973,997 H373R probably damaging Het
Csmd3 T C 15: 47,741,194 N1051S probably damaging Het
Csmd3 G A 15: 48,673,419 T129M probably damaging Het
F12 T C 13: 55,420,385 H432R probably damaging Het
Foxm1 T C 6: 128,373,476 F595S probably damaging Het
Foxred2 A T 15: 77,948,477 I410N probably benign Het
Fstl5 T A 3: 76,429,847 F238I possibly damaging Het
Galnt3 A G 2: 66,085,292 V575A probably benign Het
Gm13088 A T 4: 143,654,406 F349Y probably damaging Het
Gpr149 T A 3: 62,595,151 Y428F probably benign Het
Gtf2ird1 A T 5: 134,361,025 Y970* probably null Het
Hint2 G C 4: 43,654,343 Q157E probably damaging Het
Ighe T C 12: 113,271,386 T385A Het
Kcnc4 G A 3: 107,448,080 R351C probably damaging Het
Kif7 A G 7: 79,707,532 L642S possibly damaging Het
Lilra5 T A 7: 4,238,664 V154D probably damaging Het
Morc2b A G 17: 33,135,768 L1010P probably damaging Het
Mphosph10 C A 7: 64,377,339 K575N probably damaging Het
Mup7 C A 4: 60,067,537 E193* probably null Het
Nbea T C 3: 56,090,994 T131A probably damaging Het
Nostrin T C 2: 69,175,716 I248T probably damaging Het
Nrxn3 A T 12: 89,187,150 I296F possibly damaging Het
Odam A G 5: 87,889,463 E172G probably damaging Het
Olfr198 G C 16: 59,201,566 P287A probably damaging Het
Optn A G 2: 5,027,112 probably null Het
Osbpl8 T A 10: 111,276,475 Y484N probably damaging Het
Patj A G 4: 98,591,969 N1308D probably damaging Het
Pcdhb17 A T 18: 37,485,748 E197V probably benign Het
Pcolce2 G A 9: 95,681,572 D204N possibly damaging Het
Plxna4 T G 6: 32,197,091 T1190P probably benign Het
Pzp T C 6: 128,523,987 Y136C probably damaging Het
Scn10a A T 9: 119,617,725 N1411K probably damaging Het
Scube1 A G 15: 83,676,963 C143R probably damaging Het
Stau1 T C 2: 166,951,346 T290A probably benign Het
Sycp1 T A 3: 102,865,105 K629I probably damaging Het
Taf1d A G 9: 15,310,028 E210G probably damaging Het
Tecpr1 T C 5: 144,216,299 E204G possibly damaging Het
Tmem229a T C 6: 24,955,188 D189G probably benign Het
Tmem269 G A 4: 119,205,679 P254S probably damaging Het
Top1 T A 2: 160,721,549 F767I probably damaging Het
Ube2q2 C A 9: 55,195,473 A331D Het
Usp1 A G 4: 98,934,780 Y777C probably damaging Het
Usp29 A G 7: 6,961,892 N245D probably benign Het
Vmn1r212 T A 13: 22,883,356 Q269L probably benign Het
Wfdc11 T A 2: 164,665,453 Y28F probably benign Het
Wwp2 A T 8: 107,483,416 D142V probably damaging Het
Other mutations in Cpn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Cpn2 APN 16 30260520 missense probably benign 0.42
IGL01954:Cpn2 APN 16 30260320 missense probably benign 0.01
IGL02458:Cpn2 APN 16 30260835 missense probably benign 0.00
IGL03036:Cpn2 APN 16 30260829 missense probably benign 0.00
BB002:Cpn2 UTSW 16 30260801 missense probably damaging 1.00
BB012:Cpn2 UTSW 16 30260801 missense probably damaging 1.00
R0118:Cpn2 UTSW 16 30260368 missense probably benign 0.04
R0541:Cpn2 UTSW 16 30259351 missense possibly damaging 0.73
R1300:Cpn2 UTSW 16 30259663 missense probably benign 0.01
R1470:Cpn2 UTSW 16 30260185 missense probably benign 0.00
R1470:Cpn2 UTSW 16 30260185 missense probably benign 0.00
R1751:Cpn2 UTSW 16 30259667 nonsense probably null
R1753:Cpn2 UTSW 16 30260100 missense probably damaging 1.00
R1761:Cpn2 UTSW 16 30260196 missense probably damaging 1.00
R1767:Cpn2 UTSW 16 30259667 nonsense probably null
R1793:Cpn2 UTSW 16 30259324 missense probably damaging 1.00
R2360:Cpn2 UTSW 16 30259503 missense probably benign 0.01
R2414:Cpn2 UTSW 16 30260574 missense probably benign 0.41
R3842:Cpn2 UTSW 16 30260518 missense probably damaging 1.00
R4934:Cpn2 UTSW 16 30260526 missense probably damaging 1.00
R4956:Cpn2 UTSW 16 30260415 missense possibly damaging 0.56
R5593:Cpn2 UTSW 16 30260080 missense probably benign 0.02
R5864:Cpn2 UTSW 16 30259683 missense probably damaging 1.00
R6755:Cpn2 UTSW 16 30260331 missense probably damaging 1.00
R7833:Cpn2 UTSW 16 30260345 missense probably damaging 1.00
R7925:Cpn2 UTSW 16 30260801 missense probably damaging 1.00
R8441:Cpn2 UTSW 16 30260031 missense probably damaging 1.00
R8679:Cpn2 UTSW 16 30259267 missense possibly damaging 0.90
R9406:Cpn2 UTSW 16 30259542 missense probably benign 0.02
R9523:Cpn2 UTSW 16 30259941 missense possibly damaging 0.89
RF021:Cpn2 UTSW 16 30259338 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTTGAGGAGACCCTAGGTG -3'
(R):5'- ACTTGAAGCAGGAGCAGCTG -3'

Sequencing Primer
(F):5'- TAGGTGAAGCAGGCCTCTCTC -3'
(R):5'- AGCTGATATGCCCGGTCAAC -3'
Posted On 2021-07-15