Mutagenetix > Incidental Mutation

Incidental Mutation 'R8845:Vps33a'

674647

Institutional Source

Beutler Lab

Gene Symbol

Vps33a

Ensembl Gene

ENSMUSG00000029434

Gene Name

VPS33A CORVET/HOPS core subunit

Synonyms

3830421M04Rik, bf

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8845 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

123528659-123573038 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 123571475 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000031388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031388]

AlphaFold

Q9D2N9

Predicted Effect

probably null
Transcript: ENSMUST00000031388

SMART Domains

Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434

Domain	Start	End	E-Value	Type
low complexity region	12	27	N/A	INTRINSIC
Pfam:Sec1	34	592	7.2e-104	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000197467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and it encodes a protein similar to the yeast class C Vps33 protein. The mammalian class C VPS proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce hypopigmentation, an extended bleeeding time and abnormal kidney function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930017K11Rik	A	T	17: 25,946,849	V488E	probably benign	Het
Abca14	C	T	7: 120,247,205	P627S	probably benign	Het
Abca4	G	A	3: 122,137,002	V1383M	probably damaging	Het
Acer3	A	G	7: 98,261,625	S77P	probably damaging	Het
Adgrv1	G	T	13: 81,481,359	T3640N	possibly damaging	Het
Agmo	T	C	12: 37,244,365	L104P	probably benign	Het
Alox12	C	A	11: 70,247,051	G421V	probably damaging	Het
Atad2	A	G	15: 58,126,136	V182A	probably damaging	Het
Bnc2	C	T	4: 84,276,101	A929T	possibly damaging	Het
Bola3	T	C	6: 83,358,172	M83T	probably damaging	Het
Brca2	T	C	5: 150,543,382	F2204L	possibly damaging	Het
Cachd1	T	C	4: 100,953,146	V315A	probably benign	Het
Ccdc154	C	A	17: 25,171,164	N547K	probably damaging	Het
Ccdc62	C	A	5: 123,954,407	T485K	probably benign	Het
Cdc40	G	A	10: 40,841,794	T371I	possibly damaging	Het
Cep112	T	C	11: 108,570,367	F657L	probably damaging	Het
Cirbp	A	G	10: 80,170,097	D62G	probably damaging	Het
Cntf	A	C	19: 12,764,300	S65R	probably benign	Het
Cxxc4	CGGC	CGGCGGGGGC	3: 134,240,151		probably benign	Het
Cyfip1	G	T	7: 55,930,086	G1229V	probably benign	Het
Cyp4a30b	A	C	4: 115,458,296	N238T	probably benign	Het
Dbx2	G	A	15: 95,654,636	R43C	probably benign	Het
Fbxw13	G	T	9: 109,194,765	F70L	possibly damaging	Het
Fhod3	A	G	18: 25,132,919	T1555A	probably damaging	Het
Fnbp4	A	G	2: 90,776,024	M763V	probably benign	Het
Gdf7	A	G	12: 8,298,905	S131P	unknown	Het
Gm11639	A	T	11: 105,008,961	I4350F	possibly damaging	Het
Gm9938	A	T	19: 23,724,577	E93V	unknown	Het
Golim4	A	T	3: 75,894,965	M340K	probably damaging	Het
Gphn	A	G	12: 78,492,179	S200G	probably benign	Het
Hpse	T	C	5: 100,711,382	D99G	probably benign	Het
Iqgap2	A	T	13: 95,657,884	N1193K	possibly damaging	Het
Jag2	A	T	12: 112,920,094	C256S	probably damaging	Het
Ldb3	T	C	14: 34,536,677	Y657C	probably damaging	Het
Lmtk2	T	A	5: 144,173,886	Y475N	probably damaging	Het
Mep1b	A	T	18: 21,097,322	K644*	probably null	Het
Muc4	A	C	16: 32,756,515	T60P	possibly damaging	Het
Nckap5	G	T	1: 125,981,686	Q1603K	possibly damaging	Het
Npy6r	C	T	18: 44,275,539	T9I	probably benign	Het
Nsd2	T	C	5: 33,882,541	C846R	probably damaging	Het
Oard1	A	C	17: 48,414,231	K64Q	probably benign	Het
Olfr1151	G	T	2: 87,857,201	V9L	probably benign	Het
Olfr1195	T	A	2: 88,683,391	I114F	possibly damaging	Het
Olfr603	A	T	7: 103,383,150	V284D	probably damaging	Het
Olfr784	A	G	10: 129,388,196	T188A	probably damaging	Het
Pkhd1l1	T	G	15: 44,505,254	S823A	probably benign	Het
Pla2r1	A	G	2: 60,428,709	S1112P	possibly damaging	Het
Plekho2	T	C	9: 65,558,681	T142A	probably damaging	Het
Prrc2b	T	A	2: 32,212,093	M726K	possibly damaging	Het
Prrc2b	A	T	2: 32,216,150	K1514I	possibly damaging	Het
Rin1	A	T	19: 5,054,919	D669V	probably damaging	Het
Setd1b	C	T	5: 123,144,247	A146V	unknown	Het
Sigmar1	G	A	4: 41,741,234	R7W	probably damaging	Het
Slain1	C	T	14: 103,688,311	T365I	possibly damaging	Het
Slc38a2	G	A	15: 96,695,019	T186I	probably benign	Het
Tas2r130	A	T	6: 131,630,679	V51E	probably benign	Het
Tgfb1i1	A	T	7: 128,252,518	H332L	possibly damaging	Het
Trav7n-4	T	C	14: 53,091,389	L15S	probably damaging	Het
Ttc28	T	C	5: 111,224,175	V861A	probably benign	Het
Ttn	T	C	2: 76,776,036	E18143G	probably damaging	Het
Ttn	A	G	2: 76,802,314	I14132T	probably damaging	Het
Vmn1r203	C	T	13: 22,524,550	S167L	possibly damaging	Het
Vmn2r108	A	T	17: 20,471,099	H387Q	probably benign	Het
Vps50	G	A	6: 3,504,926	V31I	probably benign	Het
Wdcp	A	G	12: 4,851,439	T432A	probably benign	Het
Wdr36	T	A	18: 32,861,045	Y645*	probably null	Het

Other mutations in Vps33a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01345:Vps33a	APN	5	123572943	missense	probably benign	0.00
IGL01459:Vps33a	APN	5	123535308	missense	probably benign	0.08
IGL02473:Vps33a	APN	5	123569571	missense	probably damaging	1.00
IGL02899:Vps33a	APN	5	123531176	missense	probably damaging	1.00
R0498:Vps33a	UTSW	5	123570961	missense	probably benign	0.40
R1134:Vps33a	UTSW	5	123570912	missense	probably damaging	0.97
R1928:Vps33a	UTSW	5	123558621	missense	probably benign	0.02
R2012:Vps33a	UTSW	5	123531181	splice site	probably null
R2926:Vps33a	UTSW	5	123569571	missense	possibly damaging	0.83
R3688:Vps33a	UTSW	5	123535211	splice site	probably null
R3872:Vps33a	UTSW	5	123531192	missense	probably benign	0.16
R4437:Vps33a	UTSW	5	123531884	missense	probably benign
R5153:Vps33a	UTSW	5	123558628	missense	probably damaging	1.00
R5396:Vps33a	UTSW	5	123558630	missense	probably damaging	0.98
R5686:Vps33a	UTSW	5	123547001	critical splice donor site	probably null
R5714:Vps33a	UTSW	5	123569500	missense	probably benign
R5814:Vps33a	UTSW	5	123565056	missense	probably damaging	1.00
R6845:Vps33a	UTSW	5	123535272	missense	probably benign	0.02
R7183:Vps33a	UTSW	5	123535215	missense	probably null	0.83
R7359:Vps33a	UTSW	5	123558633	missense	probably benign	0.00
R7593:Vps33a	UTSW	5	123536556	missense	probably benign	0.00
R7855:Vps33a	UTSW	5	123570979	missense	possibly damaging	0.78
R7885:Vps33a	UTSW	5	123535249	missense	possibly damaging	0.70
R8025:Vps33a	UTSW	5	123558675	missense	possibly damaging	0.76
R8139:Vps33a	UTSW	5	123533952	missense	probably benign	0.04
R8275:Vps33a	UTSW	5	123569459	missense	probably damaging	0.99
R8434:Vps33a	UTSW	5	123533881	missense	possibly damaging	0.74
R8879:Vps33a	UTSW	5	123533899	missense	probably damaging	1.00
R8880:Vps33a	UTSW	5	123569443	missense	probably damaging	0.98
R9172:Vps33a	UTSW	5	123536541	missense	probably benign	0.17
R9440:Vps33a	UTSW	5	123564984	missense	probably damaging	1.00
R9502:Vps33a	UTSW	5	123558642	missense	probably benign	0.00
R9725:Vps33a	UTSW	5	123531072	missense	possibly damaging	0.95
X0026:Vps33a	UTSW	5	123547097	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- GCTTGTGCGCAAAATGGTTG -3'
(R):5'- AGGCTATAATGTGACCAGAGCC -3'

Sequencing Primer
(F):5'- ATGCTGGACATCAATTTCGGC -3'
(R):5'- CCCCAGATCCTTGGAAATTTGATGG -3'

Posted On

2021-07-15