Incidental Mutation 'R8845:Gdf7'
ID 674668
Institutional Source Beutler Lab
Gene Symbol Gdf7
Ensembl Gene ENSMUSG00000037660
Gene Name growth differentiation factor 7
Synonyms BMP12
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.850) question?
Stock # R8845 (G1)
Quality Score 197.009
Status Not validated
Chromosome 12
Chromosomal Location 8297918-8301954 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8298905 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 131 (S131P)
Ref Sequence ENSEMBL: ENSMUSP00000151234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037313] [ENSMUST00000220073]
AlphaFold P43029
Predicted Effect unknown
Transcript: ENSMUST00000037313
AA Change: S139P
SMART Domains Protein: ENSMUSP00000038301
Gene: ENSMUSG00000037660
AA Change: S139P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TGFb_propeptide 49 275 2.3e-15 PFAM
low complexity region 281 302 N/A INTRINSIC
low complexity region 308 357 N/A INTRINSIC
TGFB 360 461 1.14e-63 SMART
Predicted Effect unknown
Transcript: ENSMUST00000220073
AA Change: S131P
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein may play a role in the differentiation of tendon cells and spinal cord interneurons. Mice lacking a functional copy of this gene exhibit absence of some spinal dopaminergic neurons and brain defects, male sterility, and premature death. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele lack D1A neurons in the dorsal spinal cord; some develop severe hydrocephaly with dilated ventricles and late-onset brain defects. Mice homozygous for another null allele show premature death, hydrocephaly, aberrant seminal vesicle development and male sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A T 17: 25,946,849 V488E probably benign Het
Abca14 C T 7: 120,247,205 P627S probably benign Het
Abca4 G A 3: 122,137,002 V1383M probably damaging Het
Acer3 A G 7: 98,261,625 S77P probably damaging Het
Adgrv1 G T 13: 81,481,359 T3640N possibly damaging Het
Agmo T C 12: 37,244,365 L104P probably benign Het
Alox12 C A 11: 70,247,051 G421V probably damaging Het
Atad2 A G 15: 58,126,136 V182A probably damaging Het
Bnc2 C T 4: 84,276,101 A929T possibly damaging Het
Bola3 T C 6: 83,358,172 M83T probably damaging Het
Brca2 T C 5: 150,543,382 F2204L possibly damaging Het
Cachd1 T C 4: 100,953,146 V315A probably benign Het
Ccdc154 C A 17: 25,171,164 N547K probably damaging Het
Ccdc62 C A 5: 123,954,407 T485K probably benign Het
Cdc40 G A 10: 40,841,794 T371I possibly damaging Het
Cep112 T C 11: 108,570,367 F657L probably damaging Het
Cirbp A G 10: 80,170,097 D62G probably damaging Het
Cntf A C 19: 12,764,300 S65R probably benign Het
Cxxc4 CGGC CGGCGGGGGC 3: 134,240,151 probably benign Het
Cyfip1 G T 7: 55,930,086 G1229V probably benign Het
Cyp4a30b A C 4: 115,458,296 N238T probably benign Het
Dbx2 G A 15: 95,654,636 R43C probably benign Het
Fbxw13 G T 9: 109,194,765 F70L possibly damaging Het
Fhod3 A G 18: 25,132,919 T1555A probably damaging Het
Fnbp4 A G 2: 90,776,024 M763V probably benign Het
Gm11639 A T 11: 105,008,961 I4350F possibly damaging Het
Gm9938 A T 19: 23,724,577 E93V unknown Het
Golim4 A T 3: 75,894,965 M340K probably damaging Het
Gphn A G 12: 78,492,179 S200G probably benign Het
Hpse T C 5: 100,711,382 D99G probably benign Het
Iqgap2 A T 13: 95,657,884 N1193K possibly damaging Het
Jag2 A T 12: 112,920,094 C256S probably damaging Het
Ldb3 T C 14: 34,536,677 Y657C probably damaging Het
Lmtk2 T A 5: 144,173,886 Y475N probably damaging Het
Mep1b A T 18: 21,097,322 K644* probably null Het
Muc4 A C 16: 32,756,515 T60P possibly damaging Het
Nckap5 G T 1: 125,981,686 Q1603K possibly damaging Het
Npy6r C T 18: 44,275,539 T9I probably benign Het
Nsd2 T C 5: 33,882,541 C846R probably damaging Het
Oard1 A C 17: 48,414,231 K64Q probably benign Het
Olfr1151 G T 2: 87,857,201 V9L probably benign Het
Olfr1195 T A 2: 88,683,391 I114F possibly damaging Het
Olfr603 A T 7: 103,383,150 V284D probably damaging Het
Olfr784 A G 10: 129,388,196 T188A probably damaging Het
Pkhd1l1 T G 15: 44,505,254 S823A probably benign Het
Pla2r1 A G 2: 60,428,709 S1112P possibly damaging Het
Plekho2 T C 9: 65,558,681 T142A probably damaging Het
Prrc2b T A 2: 32,212,093 M726K possibly damaging Het
Prrc2b A T 2: 32,216,150 K1514I possibly damaging Het
Rin1 A T 19: 5,054,919 D669V probably damaging Het
Setd1b C T 5: 123,144,247 A146V unknown Het
Sigmar1 G A 4: 41,741,234 R7W probably damaging Het
Slain1 C T 14: 103,688,311 T365I possibly damaging Het
Slc38a2 G A 15: 96,695,019 T186I probably benign Het
Tas2r130 A T 6: 131,630,679 V51E probably benign Het
Tgfb1i1 A T 7: 128,252,518 H332L possibly damaging Het
Trav7n-4 T C 14: 53,091,389 L15S probably damaging Het
Ttc28 T C 5: 111,224,175 V861A probably benign Het
Ttn T C 2: 76,776,036 E18143G probably damaging Het
Ttn A G 2: 76,802,314 I14132T probably damaging Het
Vmn1r203 C T 13: 22,524,550 S167L possibly damaging Het
Vmn2r108 A T 17: 20,471,099 H387Q probably benign Het
Vps33a A T 5: 123,571,475 probably null Het
Vps50 G A 6: 3,504,926 V31I probably benign Het
Wdcp A G 12: 4,851,439 T432A probably benign Het
Wdr36 T A 18: 32,861,045 Y645* probably null Het
Other mutations in Gdf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02796:Gdf7 UTSW 12 8301666 missense unknown
R0781:Gdf7 UTSW 12 8301555 splice site probably benign
R1457:Gdf7 UTSW 12 8298073 missense probably damaging 0.97
R1556:Gdf7 UTSW 12 8301698 missense unknown
R1643:Gdf7 UTSW 12 8297971 missense probably damaging 1.00
R2010:Gdf7 UTSW 12 8301729 missense unknown
R2439:Gdf7 UTSW 12 8298050 missense probably damaging 1.00
R2899:Gdf7 UTSW 12 8298470 missense unknown
R3894:Gdf7 UTSW 12 8298845 missense unknown
R4854:Gdf7 UTSW 12 8298014 missense probably damaging 0.99
R5207:Gdf7 UTSW 12 8298371 missense unknown
R6199:Gdf7 UTSW 12 8298832 missense unknown
R6583:Gdf7 UTSW 12 8301758 missense unknown
R7687:Gdf7 UTSW 12 8298257 nonsense probably null
R7745:Gdf7 UTSW 12 8301854 missense unknown
R8705:Gdf7 UTSW 12 8298167 missense probably damaging 0.96
R9100:Gdf7 UTSW 12 8298652 missense unknown
Z1176:Gdf7 UTSW 12 8298409 missense unknown
Z1176:Gdf7 UTSW 12 8298578 missense unknown
Predicted Primers PCR Primer
(F):5'- TACGGGAGGAGATCACCAAC -3'
(R):5'- ACGCTTGCTCGCTCTTATGG -3'

Sequencing Primer
(F):5'- AGAACTTGCGGGAGGCTC -3'
(R):5'- CGCTCTTATGGTCCTTTCTGGG -3'
Posted On 2021-07-15