Incidental Mutation 'R8845:Jag2'
ID 674671
Institutional Source Beutler Lab
Gene Symbol Jag2
Ensembl Gene ENSMUSG00000002799
Gene Name jagged 2
Synonyms Serh, D12Ggc2e
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8845 (G1)
Quality Score 222.009
Status Not validated
Chromosome 12
Chromosomal Location 112907819-112929776 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 112920094 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 256 (C256S)
Ref Sequence ENSEMBL: ENSMUSP00000075224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075827]
AlphaFold Q9QYE5
Predicted Effect probably damaging
Transcript: ENSMUST00000075827
AA Change: C256S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075224
Gene: ENSMUSG00000002799
AA Change: C256S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MNNL 26 105 4.2e-31 PFAM
low complexity region 108 123 N/A INTRINSIC
DSL 178 240 1.48e-36 SMART
EGF_like 244 274 7.23e1 SMART
EGF 275 305 4.56e0 SMART
EGF_CA 307 345 8.5e-9 SMART
EGF 350 383 4e-5 SMART
EGF_CA 385 421 5.39e-11 SMART
EGF_CA 423 459 3.51e-10 SMART
EGF_CA 461 496 1.01e-10 SMART
EGF_CA 498 534 1.17e-6 SMART
EGF_CA 536 572 6.35e-8 SMART
EGF 588 634 7.53e-1 SMART
EGF_CA 636 672 2.89e-11 SMART
EGF 677 710 3.68e-4 SMART
EGF 715 748 1.32e-5 SMART
EGF 754 787 1.34e-6 SMART
EGF_CA 789 825 2.58e-8 SMART
EGF_CA 827 863 7.23e-12 SMART
VWC 872 949 1.3e-1 SMART
low complexity region 1002 1035 N/A INTRINSIC
transmembrane domain 1085 1107 N/A INTRINSIC
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1170 1199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223140
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Notch signaling pathway is an intercellular signaling mechanism that is essential for proper embryonic development. Members of the Notch gene family encode transmembrane receptors that are critical for various cell fate decisions. The protein encoded by this gene is one of several ligands that activate Notch and related receptors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die perinatally with craniofacial defects, fused digits, and increased numbers of sensory hair cells in the cochlea. Homozygotes for a spontaneous mutation exhibit fused digits and sometimes tail kinks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A T 17: 25,946,849 V488E probably benign Het
Abca14 C T 7: 120,247,205 P627S probably benign Het
Abca4 G A 3: 122,137,002 V1383M probably damaging Het
Acer3 A G 7: 98,261,625 S77P probably damaging Het
Adgrv1 G T 13: 81,481,359 T3640N possibly damaging Het
Agmo T C 12: 37,244,365 L104P probably benign Het
Alox12 C A 11: 70,247,051 G421V probably damaging Het
Atad2 A G 15: 58,126,136 V182A probably damaging Het
Bnc2 C T 4: 84,276,101 A929T possibly damaging Het
Bola3 T C 6: 83,358,172 M83T probably damaging Het
Brca2 T C 5: 150,543,382 F2204L possibly damaging Het
Cachd1 T C 4: 100,953,146 V315A probably benign Het
Ccdc154 C A 17: 25,171,164 N547K probably damaging Het
Ccdc62 C A 5: 123,954,407 T485K probably benign Het
Cdc40 G A 10: 40,841,794 T371I possibly damaging Het
Cep112 T C 11: 108,570,367 F657L probably damaging Het
Cirbp A G 10: 80,170,097 D62G probably damaging Het
Cntf A C 19: 12,764,300 S65R probably benign Het
Cxxc4 CGGC CGGCGGGGGC 3: 134,240,151 probably benign Het
Cyfip1 G T 7: 55,930,086 G1229V probably benign Het
Cyp4a30b A C 4: 115,458,296 N238T probably benign Het
Dbx2 G A 15: 95,654,636 R43C probably benign Het
Fbxw13 G T 9: 109,194,765 F70L possibly damaging Het
Fhod3 A G 18: 25,132,919 T1555A probably damaging Het
Fnbp4 A G 2: 90,776,024 M763V probably benign Het
Gdf7 A G 12: 8,298,905 S131P unknown Het
Gm11639 A T 11: 105,008,961 I4350F possibly damaging Het
Gm9938 A T 19: 23,724,577 E93V unknown Het
Golim4 A T 3: 75,894,965 M340K probably damaging Het
Gphn A G 12: 78,492,179 S200G probably benign Het
Hpse T C 5: 100,711,382 D99G probably benign Het
Iqgap2 A T 13: 95,657,884 N1193K possibly damaging Het
Ldb3 T C 14: 34,536,677 Y657C probably damaging Het
Lmtk2 T A 5: 144,173,886 Y475N probably damaging Het
Mep1b A T 18: 21,097,322 K644* probably null Het
Muc4 A C 16: 32,756,515 T60P possibly damaging Het
Nckap5 G T 1: 125,981,686 Q1603K possibly damaging Het
Npy6r C T 18: 44,275,539 T9I probably benign Het
Nsd2 T C 5: 33,882,541 C846R probably damaging Het
Oard1 A C 17: 48,414,231 K64Q probably benign Het
Olfr1151 G T 2: 87,857,201 V9L probably benign Het
Olfr1195 T A 2: 88,683,391 I114F possibly damaging Het
Olfr603 A T 7: 103,383,150 V284D probably damaging Het
Olfr784 A G 10: 129,388,196 T188A probably damaging Het
Pkhd1l1 T G 15: 44,505,254 S823A probably benign Het
Pla2r1 A G 2: 60,428,709 S1112P possibly damaging Het
Plekho2 T C 9: 65,558,681 T142A probably damaging Het
Prrc2b T A 2: 32,212,093 M726K possibly damaging Het
Prrc2b A T 2: 32,216,150 K1514I possibly damaging Het
Rin1 A T 19: 5,054,919 D669V probably damaging Het
Setd1b C T 5: 123,144,247 A146V unknown Het
Sigmar1 G A 4: 41,741,234 R7W probably damaging Het
Slain1 C T 14: 103,688,311 T365I possibly damaging Het
Slc38a2 G A 15: 96,695,019 T186I probably benign Het
Tas2r130 A T 6: 131,630,679 V51E probably benign Het
Tgfb1i1 A T 7: 128,252,518 H332L possibly damaging Het
Trav7n-4 T C 14: 53,091,389 L15S probably damaging Het
Ttc28 T C 5: 111,224,175 V861A probably benign Het
Ttn T C 2: 76,776,036 E18143G probably damaging Het
Ttn A G 2: 76,802,314 I14132T probably damaging Het
Vmn1r203 C T 13: 22,524,550 S167L possibly damaging Het
Vmn2r108 A T 17: 20,471,099 H387Q probably benign Het
Vps33a A T 5: 123,571,475 probably null Het
Vps50 G A 6: 3,504,926 V31I probably benign Het
Wdcp A G 12: 4,851,439 T432A probably benign Het
Wdr36 T A 18: 32,861,045 Y645* probably null Het
Other mutations in Jag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Jag2 APN 12 112912718 missense probably benign 0.20
IGL00954:Jag2 APN 12 112920406 missense possibly damaging 0.50
IGL01532:Jag2 APN 12 112914363 missense probably damaging 0.98
IGL01646:Jag2 APN 12 112916349 missense possibly damaging 0.65
IGL02243:Jag2 APN 12 112916345 missense possibly damaging 0.94
IGL02447:Jag2 APN 12 112912612 missense probably damaging 1.00
IGL02458:Jag2 APN 12 112915993 missense probably damaging 0.98
IGL02516:Jag2 APN 12 112910566 missense probably damaging 1.00
IGL02574:Jag2 APN 12 112915511 missense probably benign 0.32
IGL02629:Jag2 APN 12 112914514 splice site probably benign
IGL02873:Jag2 APN 12 112910502 missense probably benign 0.00
IGL03087:Jag2 APN 12 112913948 missense possibly damaging 0.60
Jaguarundi UTSW 12 112915469 critical splice donor site probably null
R0068:Jag2 UTSW 12 112915193 splice site probably benign
R0310:Jag2 UTSW 12 112913377 unclassified probably benign
R0963:Jag2 UTSW 12 112915314 missense probably damaging 1.00
R1188:Jag2 UTSW 12 112920121 nonsense probably null
R1256:Jag2 UTSW 12 112914419 missense possibly damaging 0.50
R1298:Jag2 UTSW 12 112916319 unclassified probably benign
R1317:Jag2 UTSW 12 112914501 missense probably benign
R2079:Jag2 UTSW 12 112920377 missense probably damaging 1.00
R2345:Jag2 UTSW 12 112909064 missense probably damaging 1.00
R4654:Jag2 UTSW 12 112913646 missense probably benign 0.13
R4782:Jag2 UTSW 12 112914249 missense probably benign
R4798:Jag2 UTSW 12 112916632 missense probably benign 0.01
R5242:Jag2 UTSW 12 112916866 missense probably damaging 0.97
R5350:Jag2 UTSW 12 112908922 missense possibly damaging 0.77
R5364:Jag2 UTSW 12 112910534 missense probably damaging 1.00
R6129:Jag2 UTSW 12 112920349 nonsense probably null
R6362:Jag2 UTSW 12 112920122 missense probably damaging 0.97
R6376:Jag2 UTSW 12 112909329 missense probably benign 0.00
R6819:Jag2 UTSW 12 112910541 missense probably damaging 1.00
R6844:Jag2 UTSW 12 112916714 missense probably damaging 1.00
R6968:Jag2 UTSW 12 112914258 missense probably benign 0.10
R7514:Jag2 UTSW 12 112929052 missense probably benign 0.19
R7663:Jag2 UTSW 12 112913666 missense probably damaging 1.00
R7730:Jag2 UTSW 12 112922041 missense probably damaging 1.00
R7754:Jag2 UTSW 12 112915469 critical splice donor site probably null
R7828:Jag2 UTSW 12 112913180 missense probably benign 0.19
R7874:Jag2 UTSW 12 112915946 missense probably damaging 0.99
R8075:Jag2 UTSW 12 112915274 missense probably benign 0.05
R8876:Jag2 UTSW 12 112909637 missense probably benign 0.00
R9117:Jag2 UTSW 12 112913659 nonsense probably null
R9400:Jag2 UTSW 12 112911988 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTAAGGGCAGGGTTCCATTC -3'
(R):5'- TTTGGCCACTATACCTGCGAC -3'

Sequencing Primer
(F):5'- GCAGGGTTCCATTCCAACTCTATAG -3'
(R):5'- TATACCTGCGACCAGTACGG -3'
Posted On 2021-07-15