Incidental Mutation 'R8845:Iqgap2'
ID 674674
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene Name IQ motif containing GTPase activating protein 2
Synonyms 4933417J23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8845 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 95627177-95891922 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 95657884 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1193 (N1193K)
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
AlphaFold Q3UQ44
Predicted Effect possibly damaging
Transcript: ENSMUST00000068603
AA Change: N1193K

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: N1193K

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A T 17: 25,946,849 V488E probably benign Het
Abca14 C T 7: 120,247,205 P627S probably benign Het
Abca4 G A 3: 122,137,002 V1383M probably damaging Het
Acer3 A G 7: 98,261,625 S77P probably damaging Het
Adgrv1 G T 13: 81,481,359 T3640N possibly damaging Het
Agmo T C 12: 37,244,365 L104P probably benign Het
Alox12 C A 11: 70,247,051 G421V probably damaging Het
Atad2 A G 15: 58,126,136 V182A probably damaging Het
Bnc2 C T 4: 84,276,101 A929T possibly damaging Het
Bola3 T C 6: 83,358,172 M83T probably damaging Het
Brca2 T C 5: 150,543,382 F2204L possibly damaging Het
Cachd1 T C 4: 100,953,146 V315A probably benign Het
Ccdc154 C A 17: 25,171,164 N547K probably damaging Het
Ccdc62 C A 5: 123,954,407 T485K probably benign Het
Cdc40 G A 10: 40,841,794 T371I possibly damaging Het
Cep112 T C 11: 108,570,367 F657L probably damaging Het
Cirbp A G 10: 80,170,097 D62G probably damaging Het
Cntf A C 19: 12,764,300 S65R probably benign Het
Cxxc4 CGGC CGGCGGGGGC 3: 134,240,151 probably benign Het
Cyfip1 G T 7: 55,930,086 G1229V probably benign Het
Cyp4a30b A C 4: 115,458,296 N238T probably benign Het
Dbx2 G A 15: 95,654,636 R43C probably benign Het
Fbxw13 G T 9: 109,194,765 F70L possibly damaging Het
Fhod3 A G 18: 25,132,919 T1555A probably damaging Het
Fnbp4 A G 2: 90,776,024 M763V probably benign Het
Gdf7 A G 12: 8,298,905 S131P unknown Het
Gm11639 A T 11: 105,008,961 I4350F possibly damaging Het
Gm9938 A T 19: 23,724,577 E93V unknown Het
Golim4 A T 3: 75,894,965 M340K probably damaging Het
Gphn A G 12: 78,492,179 S200G probably benign Het
Hpse T C 5: 100,711,382 D99G probably benign Het
Jag2 A T 12: 112,920,094 C256S probably damaging Het
Ldb3 T C 14: 34,536,677 Y657C probably damaging Het
Lmtk2 T A 5: 144,173,886 Y475N probably damaging Het
Mep1b A T 18: 21,097,322 K644* probably null Het
Muc4 A C 16: 32,756,515 T60P possibly damaging Het
Nckap5 G T 1: 125,981,686 Q1603K possibly damaging Het
Npy6r C T 18: 44,275,539 T9I probably benign Het
Nsd2 T C 5: 33,882,541 C846R probably damaging Het
Oard1 A C 17: 48,414,231 K64Q probably benign Het
Olfr1151 G T 2: 87,857,201 V9L probably benign Het
Olfr1195 T A 2: 88,683,391 I114F possibly damaging Het
Olfr603 A T 7: 103,383,150 V284D probably damaging Het
Olfr784 A G 10: 129,388,196 T188A probably damaging Het
Pkhd1l1 T G 15: 44,505,254 S823A probably benign Het
Pla2r1 A G 2: 60,428,709 S1112P possibly damaging Het
Plekho2 T C 9: 65,558,681 T142A probably damaging Het
Prrc2b T A 2: 32,212,093 M726K possibly damaging Het
Prrc2b A T 2: 32,216,150 K1514I possibly damaging Het
Rin1 A T 19: 5,054,919 D669V probably damaging Het
Setd1b C T 5: 123,144,247 A146V unknown Het
Sigmar1 G A 4: 41,741,234 R7W probably damaging Het
Slain1 C T 14: 103,688,311 T365I possibly damaging Het
Slc38a2 G A 15: 96,695,019 T186I probably benign Het
Tas2r130 A T 6: 131,630,679 V51E probably benign Het
Tgfb1i1 A T 7: 128,252,518 H332L possibly damaging Het
Trav7n-4 T C 14: 53,091,389 L15S probably damaging Het
Ttc28 T C 5: 111,224,175 V861A probably benign Het
Ttn T C 2: 76,776,036 E18143G probably damaging Het
Ttn A G 2: 76,802,314 I14132T probably damaging Het
Vmn1r203 C T 13: 22,524,550 S167L possibly damaging Het
Vmn2r108 A T 17: 20,471,099 H387Q probably benign Het
Vps33a A T 5: 123,571,475 probably null Het
Vps50 G A 6: 3,504,926 V31I probably benign Het
Wdcp A G 12: 4,851,439 T432A probably benign Het
Wdr36 T A 18: 32,861,045 Y645* probably null Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95657944 splice site probably benign
IGL01968:Iqgap2 APN 13 95635582 missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95675405 splice site probably benign
IGL02195:Iqgap2 APN 13 95661734 splice site probably benign
IGL02387:Iqgap2 APN 13 95689701 missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95628114 missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95628056 missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95671404 missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95724676 missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95661735 splice site probably benign
IGL03167:Iqgap2 APN 13 95684898 missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95731277 splice site probably null
IGL03293:Iqgap2 APN 13 95731434 missense probably damaging 1.00
G1Funyon:Iqgap2 UTSW 13 95682151 critical splice donor site probably null
R0257:Iqgap2 UTSW 13 95724544 critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95635633 missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95731275 splice site probably benign
R0364:Iqgap2 UTSW 13 95731275 splice site probably benign
R0419:Iqgap2 UTSW 13 95689699 critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95668513 missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1498:Iqgap2 UTSW 13 95646805 missense probably benign
R1513:Iqgap2 UTSW 13 95630010 missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95689785 missense probably benign
R2088:Iqgap2 UTSW 13 95891663 critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95682236 missense probably benign
R3026:Iqgap2 UTSW 13 95673056 critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95668528 splice site probably null
R3846:Iqgap2 UTSW 13 95673678 splice site probably benign
R4056:Iqgap2 UTSW 13 95750033 missense probably damaging 1.00
R4077:Iqgap2 UTSW 13 95657867 missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95671396 missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95664061 critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95763329 missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95721609 missense probably damaging 0.98
R4724:Iqgap2 UTSW 13 95635497 missense possibly damaging 0.73
R4826:Iqgap2 UTSW 13 95763275 missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95630006 missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95657797 splice site probably null
R5010:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95635580 missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95630053 missense probably damaging 1.00
R5512:Iqgap2 UTSW 13 95675376 nonsense probably null
R5629:Iqgap2 UTSW 13 95632174 missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5830:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5833:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5888:Iqgap2 UTSW 13 95635610 missense possibly damaging 0.89
R5889:Iqgap2 UTSW 13 95632042 missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95628963 missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95721686 splice site probably null
R6404:Iqgap2 UTSW 13 95729477 missense probably benign 0.28
R6434:Iqgap2 UTSW 13 95682933 missense possibly damaging 0.85
R6648:Iqgap2 UTSW 13 95682211 missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95660332 missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95661057 missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95628972 missense probably damaging 1.00
R7327:Iqgap2 UTSW 13 95635655 missense probably benign 0.00
R7371:Iqgap2 UTSW 13 95700338 splice site probably null
R7378:Iqgap2 UTSW 13 95732890 critical splice donor site probably null
R7441:Iqgap2 UTSW 13 95628076 missense probably benign 0.23
R7575:Iqgap2 UTSW 13 95661623 missense probably damaging 0.99
R7671:Iqgap2 UTSW 13 95628119 missense probably damaging 0.98
R7713:Iqgap2 UTSW 13 95731444 missense probably benign 0.01
R7806:Iqgap2 UTSW 13 95682257 missense probably benign 0.00
R7893:Iqgap2 UTSW 13 95689709 missense probably damaging 0.96
R8052:Iqgap2 UTSW 13 95657879 missense probably damaging 0.96
R8121:Iqgap2 UTSW 13 95724568 missense probably benign 0.00
R8261:Iqgap2 UTSW 13 95635570 missense probably damaging 1.00
R8301:Iqgap2 UTSW 13 95682151 critical splice donor site probably null
R8369:Iqgap2 UTSW 13 95661603 missense probably damaging 1.00
R8485:Iqgap2 UTSW 13 95660151 missense probably damaging 0.99
R8709:Iqgap2 UTSW 13 95660205 missense probably damaging 0.99
R8710:Iqgap2 UTSW 13 95660248 missense probably benign 0.24
R8737:Iqgap2 UTSW 13 95665750 missense probably damaging 1.00
R8902:Iqgap2 UTSW 13 95682203 missense probably benign 0.16
R8957:Iqgap2 UTSW 13 95635646 missense probably damaging 1.00
R9153:Iqgap2 UTSW 13 95708039 missense probably benign
R9259:Iqgap2 UTSW 13 95630053 missense probably damaging 1.00
R9290:Iqgap2 UTSW 13 95750015 missense probably damaging 1.00
R9414:Iqgap2 UTSW 13 95646841 missense
R9432:Iqgap2 UTSW 13 95637753 missense probably benign
X0066:Iqgap2 UTSW 13 95671383 missense probably damaging 0.98
Z1176:Iqgap2 UTSW 13 95731443 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCAAGCGCACAGGCAATTTC -3'
(R):5'- GTCCAGCATCCAGAAACATGGG -3'

Sequencing Primer
(F):5'- CAATTTCTGCTGGGACTAGGCAC -3'
(R):5'- CCCTGGAAGATGCTAACAAGTGC -3'
Posted On 2021-07-15